Chapter 8. DNA Modeling, DNA Extraction, and Electrophoresis Simulation

Objectives

By the end of the period, students will be able to:

Introduction

There is an enormous amount of biodiversity in the world. There may be as many as 30 million species of organisms in the different kingdoms. In spite of all of the diversity, there are basic characteristics that all living organisms share. Scientists look both for shared characteristics (from a group) as well as unique characteristics to understand any given organism.

All living organisms are made of cells. All organisms use ATP for energy. And all organisms have DNA, the molecule that is the basis for the genetic code. In addition, all organisms transcribe that DNA into proteins in essentially the same way. The fact that all animals, plants, protists, fungi, and microbes share so many important traits is perhaps the strongest evidence that all living organisms are biologically related to each other.

In this lab we will look at the structure of DNA and we will build models of DNA to understand that structure. In addition, we will extract DNA from strawberries. And finally, we will run a simulated electrophoresis study to see one way that DNA is studied and to prepare for next week.

A quick review. All living organisms are made of cells. You have recently seen plant cells, animal cells, protists, fungi, and bacteria. You remember that all eukaryotic organisms have nuclei and these are one of the places where DNA is located. In the eukaryotic organisms, the DNA is in the nucleus and is organized into chromosomes, and those chromosomes become visible when the cell is dividing. In next week’s lab, you will see the stages of mitosis. In prokaryotes, the DNA forms a circular strand and there is no nucleus.

DNA is an extremely long and thin molecule that is packaged very efficiently and effectively. If the DNA from a single human cell could be stretched in a line without breaking, it would be over 2 meters long! Figure 8-1 diagrams how DNA is packaged into chromosomes. The DNA double helix is coiled onto protein nucleosomes, which in turn coil and form a chromatin fiber. The chromosome itself is a mass of chromatin fibers.

The chromosomes are thus long sections of DNA. Portions of the DNA are coding sections and are called genes. Other sections of the DNA do not code for anything. Along the length of each chromosome are thousands of genes. We will focus on eukaryotic cells and for now, will take animals as examples. You recall that all animals start life as a single fertilized egg. The egg of course contains the chromosomes from the mother and the fertilizing sperm contains chromosomes from the father. The genotype of that fertilized egg is thus a combination of the genotype from the mother and the father. Humans have 23 pairs of chromosomes (46 chromosomes total). One of each pair is from the mother, one is from the father. Other species have different numbers of chromosomes. A karyotype is the chromosomal composition of an individual. A karyotype spread is a way of looking at all of the chromosomes from one individual cell. When you make a karyotype from a human, there are 46 chromosomes. The chromosomes are arranged by size so they can be counted.

To go from this single fertilized egg to a complex animal with many working parts requires cell division, and lots of it. With each cell division, it is critical that the DNA gets duplicated and divided between the daughter cells. The DNA in a cell must first duplicate itself (called replication) and then become even more coiled or condensed. It is at this point that the DNA is visible. Finally, the chromosomes must divide in such a way that each daughter cell gets a complete set of the DNA. This process of cell division is called mitosis. We will look at plant and animal mitosis next week.

DNA is said to carry the code of life for two reasons:

The above two statements are true for all organisms that reproduce sexually, including plants, fungi, animals, and most protists.

In this lab we will first model DNA and then we will extract DNA from strawberries. We will then run a simulated electrophoresis study to prepare for next week.

Part 1. Modeling DNA

We will be using a 3-D model of DNA. Working in groups of 3 or 4, students will build a double stranded molecule of DNA. Once completed, you need to be able to explain each of the components and what kind of bonds connect each of the components.

Understanding the structure of DNA is essential to understand how DNA is replicated.

The building blocks of DNA are deoxyribose (a 5-carbon sugar), a phosphate group, and a nitrogenous base. When put together, we have the monomer of a nucleic acid, the nucleotide. Many nucleotides together make a nucleic acid.

In our Molymod models we have these components:

Please note: As you work with your teammates be sure to call each part by the correct name, as in “please pass me three more deoxyribose pieces!”

In this way we are forming the double helix, and one complete turn occurs every 10 base pairs. The large and the small grooves are the major and minor grooves.

As you are building your model, your TA will circulate and ask you questions to be sure you understand the structure! Pick one strand of your DNA to call the sense strand and write out the sequence of bases that forms this strand.

Part 2. DNA Extraction

The extraction of DNA is a straightforward process. When it is extracted from multiple cells, it is visible as translucent strands. We will use strawberries as their cells are octoploid and thus have many copies of DNA.

Once DNA is extracted it can be studied in a variety of ways. Portions of DNA can be used to determine identity, study genomes of organisms, identify genetic diseases, genetically engineer crops, etc.

DNA extraction involves several steps. Recall that in eukaryotic organisms, most of the DNA is within the nucleus or other membrane-bound organelles. We will need to get the DNA out of those organelles and out of the cell itself. In addition, plants have cell walls made of cellulose that help to protect the cell.

Cell membranes are made of a phospholipid bilayer. Lipids are fats and fatty acids and can be broken down by detergents. We will use detergents to break down the cell membranes. In addition to that, however, we will also need to physically break down the cell wall. We do that physically by mashing the cells. This also allows the detergent to get to the cell membranes. The process of rupturing the cell membrane and cell wall is called lysis.

Once the cells are mashed, there will be cellular debris that we will not need. The salt added to the extraction buffer helps some of the cellular debris to precipitate, while the DNA stays in solution. We will use a filter to remove this debris. Once we have filtered the extract, we will have a liquid extract of strawberry that includes the water soluble DNA. Why is the DNA water soluble? The final step will be to pull the DNA out of solution. We do this by adding ethanol. DNA is insoluble in ethanol and so will precipitate once the ethanol is added. Voila!

Students will work in teams of two and each team will extract the DNA.

MATERIALS FOR EACH TEAM

The ethanol will be kept in an ice chest near the sink. Ethanol must be kept cold to prevent the DNA strands from separating, which increases the efficiency of the extraction.

DIRECTIONS FOR STUDENTS

Put the strawberry in the bag and seal it closed.

Mash the strawberry in your hands for two minutes. (This must be timed!)

Pour 10 ml of the extraction buffer (a type of detergent) into the bag, seal the bag, and mash the strawberry for one more minute. Again, it is important to time this!

Place a funnel in a 50 ml centrifuge tube. Fold and place cheesecloth in the funnel. Pour the strawberry mixture through the cheesecloth. Let it drip through for a few minutes. What is getting caught in the cheesecloth?

Pour 2 ml of the filtered contents into a clean 15 ml tube. Holding this tube at an angle, slowly and carefully add 5 ml of cold ethanol by pouring the ethanol down the side of the container.

Watch closely as the translucent strands of DNA become visible as the DNA precipitates out of solution.

You can then spool the DNA onto a wooden stick.

Be able to explain what each step accomplishes in the extraction procedure.

Once you have extracted DNA, in order to study it, you have to go through several steps of “cleaning” it; that is, removing cellular debris.

How do we study the DNA? That will be the focus of this next section!

Part 3. Molecular Genetics Simulation

OBJECTIVES

By doing a simulation, we will review in principle the steps involved with DNA profiling and learn the steps in using electrophoresis to study DNA.

DNA profiling (also called DNA fingerprinting) is now being used in many criminal and legal cases where DNA samples are available to determine identity or parentage. DNA may be extracted from relatively small samples of cells, such as a blood stain the size of a nickel (about 2 drops) or from a semen stain the size of a dime. When performed under properly controlled conditions and interpreted by an experienced forensic scientist, such profiling can link a suspect to a particular incident with compelling accuracy or can completely exonerate a suspect. This simulation activity allows students to work through the theory of DNA profiling and to grapple with some analytical and ethical questions. It can be used to reinforce basic concepts such as base pairing in DNA as well as teach the principles of restriction enzyme digestion, gel electrophoresis, and probe hybridization.

At the DNA level, individual people are about 99.9% identical; they differ on the average in 1 out of 1000 base pairs. Some of these differences are in genes that lead to the visible differences between us.

The most variable sequences known are tandem repeated sequences; the basic unit of a repeat is usually a sequence of 2 to 300 base pairs. In tandem repeats, each unit has the same orientation (e.g., CATCAT). Different repeated sequences appear in different places of the genome. In each case, what is variable is the number of copies of the sequence in an allele. So for example, if the repeated sequence were “CAT,” in one allele there might be 3 copies (CATCATCAT) while in another allele there might be 7 copies (CATCATCATCATCATCATCAT).

These are known as variable number tandem repeats, or VNTRs. In a given population there may be dozens or even hundreds of different alleles. Of course, any individual has only two alleles, one on each of the homologous chromosomes, each of which was inherited from one parent. Since there are so many alleles in a population, most people are heterozygous for alleles of any given VNTR. Because of the great variability in alleles of VNTR, if one examines enough different VNTRs (6–12 in a given person), one can put together a molecular picture or DNA profile or fingerprint of that person. This can be used for identification, e.g., of tissue left at a crime scene, or for paternity testing, in which case the VNTR alleles in the child that are not present in the mother must have come from the biological father.

Population studies must be done to determine the frequency of each allele in the population. Using that information, calculations may be made to determine the chance that a random person in the population would have the same alleles as the suspect or alleged father.

TECHNICAL BACKGROUND

What follows is a description of the techniques necessary to distinguish between different VNTR alleles.

In our example, we will use the enzyme HindIII, which recognizes the sequence

and cuts the DNA between the two As, leaving one fragment that ends with A_3, and another fragment that begins with

Within the human genome, this particular sequence is found at many places; therefore, Hind III will cut the human genome into many pieces, perhaps as many as a million fragments! Remember that the DNA has been isolated from millions of cells, and the enzyme will cut each chromosome in the same place so that the result will be millions of copies of each fragment.

For technical reasons, the DNA smear is transferred to a nylon filter to prevent further movement of the DNA fragments, but the bands remain in the same relative places in the filter as they were in the gel. In the process of transferring the DNA from the gel to the nylon filter, the double strands of the DNA are separated, and the filter tightly binds the now single-stranded DNA. This will permit a complementary sequence of DNA to bind to the sample DNA that stuck on the filter.

Radioactively labeled sequences of single-stranded DNA, called probes, have been produced that recognize (i.e., are complementary to) a particular DNA sequence. Under the proper conditions, the probe will bind only to sequences that are complementary to it: e.g., a probe for the CAT sequence will contain tandem repeats of GTA.

Also, labeled probes are usually at least 18 base pairs long, but for simplification in our simulation, we are using smaller sizes.

A probe that doesn’t bind is washed away, and the radioactivity is visualized by exposing X-ray film to the gel and letting the radioactive probes make a picture of themselves. This is called autoradiography. This process may be repeated by removing the first probe and adding different probes in sequence. This allows a single filter to be tested with multiple probes, each of which visualizes a different VNTR. Optimally, the VNTRs chosen for examination will come from many different chromosomes.

Electrophoresis Simulation

This is intended as a group activity, with each lab table acting as a research group. We will be using the white boards and the chalk board to simulate electrophoresis.

MATERIALS FOR EACH TEAM

The activity simulates the following situation. Blood was found at a crime scene where one person (a male named John) was assaulted. Police have a blood sample from the victim, and from three other people: One is the victim’s best friend, one was a high school buddy that showed up late one night, and the third was the victim’s girlfriend.

The police were able to type the blood at the scene and they know it was from at least two people. They are sure that some of the blood is from a male (how might they know that?) and more than that, they know it is from John, the victim. They strongly suspect that the rest of the blood was from the assailant. Who assaulted John? Molecular biology will solve this puzzle!

To simulate the restriction digest, each group will receive some already cut strips of DNA for all individuals present. These pieces of DNA have already been treated with restriction enzymes, in particular the HindIII enzyme. Each sample should be scanned for the target site: CAT.

To simulate running the gel, the standards should be placed first on the whiteboard. Exact distances from the origin in the well are not important, as long as all fragments of the same length are placed the same distance from the well. The larger fragments are placed closest to the well and the smaller ones are placed further away in descending order beneath the well. The standards should span almost the whole distance, leaving perhaps 5 cm at the bottom. Tape the fragments in place with a small amount of tape.

In the “well” next to the standard, you will run the DNA pieces from the victim. Similar lengths of DNA will run the same distance.

In the next “wells” you will place the DNA from the best friend, the high school buddy, and the victim’s girlfriend.

These fragments would still not be visible to us. They must next be differentiated from one another by use of the probe. The DNA probes will be small pieces of colored acetate sheets that will be taped over the target sequences. Remember that the probe sequence, ₃GTAGTA₅, is complementary to the VNTR sequences, ₅CATCAT₃. These are the sequences that will be visible to us.

Scan the gel and position a probe on each complementary sequence. Each labeled fragment represents a part of one chromosome of a homologous pair.

Who assaulted John? (Note that different tables may get different answers!)