Complements. The sequence of part of an mRNA is

5′–AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG–3′

What is the sequence of the DNA coding strand? Of the DNA template strand?

Checking for errors. Why is RNA synthesis not as carefully monitored for errors as is DNA synthesis?

Speed is not of the essence. Why is it advantageous for DNA synthesis to be more rapid than RNA synthesis?

891

Active sites. The overall structures of RNA polymerase and DNA polymerase are very different, yet their active sites show considerable similarities. What do the similarities suggest about the evolutionary relationship between these two important enzymes?

Potent inhibitor. Heparin inhibits transcription by binding to RNA polymerase. What properties of heparin allow it to bind so effectively to RNA polymerase?

A loose cannon. Sigma protein by itself does not bind to promoter sites. Predict the effect of a mutation enabling σ to bind to the −10 region in the absence of other subunits of RNA polymerase.

Stuck sigma. What would be the likely effect of a mutation that prevents σ from dissociating from the RNA polymerase core?

Transcription time. What is the minimum length of time required for the synthesis by E. coli polymerase of an mRNA encoding a 100-kDa protein?

Rapid search. RNA polymerase finds promoter sites very rapidly. The observed rate constant for the binding of the RNA polymerase holoenzyme to promoter sequences is 10¹⁰ M⁻¹s⁻¹. The rate constant for two macromolecules encountering each other is typically 10⁸ M⁻¹s⁻¹. Propose an explanation for the 100-fold larger rate for a protein finding a particular site along a DNA molecule.

Where to begin? Identify the likely transcription start site in the following DNA sequence:

Between bubbles. How far apart are transcription bubbles on E. coli genes that are being transcribed at a maximal rate?

A revealing bubble. Consider the synthetic RNA–DNA transcription bubble illustrated here. Refer to the coding DNA strand, the template strand, and the RNA strand as strands 1, 2, and 3, respectively.

Proofreading marks. The major products of proofreading by RNA polymerase are dinucleotides rather than mononucleotides. Why?

Abortive cycling. Di- and trinucleotides are occasionally released from RNA polymerase at the very start of transcription, a process called abortive cycling. This process requires the restart of transcription. Suggest a plausible explanation for abortive cycling.

Polymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations.

Alternative splicing. A gene contains eight sites where alternative splicing is possible. Assuming that the splicing pattern at each site is independent of that at all other sites, how many splicing products are possible?

Supercoiling. Negative supercoiling of DNA favors the transcription of genes because it facilitates unwinding. However, not all promoter sites are stimulated by negative supercoiling. The promoter site for topoisomerase II itself is a noteworthy exception. Negative supercoiling decreases the rate of transcription of this gene. Propose a possible mechanism for this effect and suggest a reason why it may occur.

892

An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3′ splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream.

What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.

A long-tailed messenger. Another thalassemic patient had a mutation leading to the production of an mRNA for the β chain of hemoglobin that was 900 nucleotides longer than the normal one. The poly(A) tail of this mutant mRNA was located a few nucleotides after the only AAUAAA sequence in the additional sequence. Propose a mutation that would lead to the production of this altered mRNA.

RNA editing. Many uridine molecules are inserted into some mitochondrial mRNAs in trypanosomes. The uridine residues come from the poly(U) tail of a donor strand. Nucleoside triphosphates do not participate in this reaction. Propose a reaction mechanism that accounts for these findings. (Hint: Relate RNA editing to RNA splicing.)

Proteome complexity. What processes considered in this chapter make the proteome more complex than the genome? What processes might further enhance this complexity?

Separation technique. Suggest a means by which you could separate mRNA from the other types of RNA in a eukaryotic cell.

Run-off experiment. Nuclei were isolated from brain, liver, and muscle. The nuclei were then incubated with α-[³²P]UTP under conditions that allow RNA synthesis, except that an inhibitor of RNA initiation was present. The radioactive RNA was isolated and annealed to various DNA sequences that had been attached to a gene chip. In the adjoining graphs, the intensity of the shading indicates roughly how much mRNA was attached to each DNA sequence.

Christmas trees. The adjoining autoradiograph depicts several bacterial genes undergoing transcription. Identify the DNA. What are the strands of increasing length? Where is the beginning of transcription? The end of transcription? On the page, what is the direction of RNA synthesis? What can you conclude about the number of enzymes participating in RNA synthesis on a given gene?