5.1 Sanger Sequencing
received a second Nobel Prize in 1980 for his work in the development of the dideoxy method of DNA sequencing.
is the enzyme required for the in vitro DNA sequencing reaction.
A total of sequencing reactions are required to generate the sequence for one DNA template.
The DNA sequence that is closest to the DNA primer being used will be the fragment and will run near the of the gel.
True or False: Dideoxy nucleotide triphosphates (ddNTPs) are missing the 2’ and 3’ hydroxyl groups and cannot be further extended in a DNA sequencing reaction.
A. |
B. |
True or False: DNA sequencing gels are read from the top down.
A. |
B. |
Click on the step and the associated process to identify the correct order for the Sanger Sequencing method.
Step 1 Step 2 Step 3 Step 4 Step 5 Step 6 Step 7 | The sequence reaction is initiated by the addition of DNA polymerase. dNTPs are added to the reaction mixture. The completed gel is transferred to filter paper, dried, and exposed to x-ray film. The reactions are analyzed by PAGE. The appropriate dideoxy nucleotide is added to each reaction tube. A short radiolabelled primer is annealed to the single-stranded DNA template. The reaction mixture is divided into four separate tubes, one for each nucleotide base (ACGT). |
Correct Matches: |
A patient is concerned that she may be a carrier for a hereditary disease. A DNA sample is taken from the patient and the gene of interest is sequenced. The wild-type gene is sequenced side by side for comparison.
Wild-Type Sequence:
5’ – ACTTCTTGGCAAGTAGGTTAAGATC – 3’
Patient X Sequence:
5’ – ACTTCTTGGCAAGTCGGTTAAGATC – 3’
After analyzing the results, what would you advise this patient?
The patient’s sequence shows both a G and C at position 16, indicating that she is heterozygous for this gene locus, carrying one wild-type allele and one mutant allele. She should be advised that she is a carrier for the disease trait.
Activity results are being submitted...