PCR Simulation

Objective

Understand the polymerase chain reaction (PCR).

Reward

Collect PCR token and unlock the Sanger Sequencing marker.

PCR Activity - Introduction

There were over 230,000 new cases of breast cancer reported nationally in 2012. 15% of these cases occur in women who have an inherited predisposition to breast cancer.

When a woman is born, she has two copies of the BRCA II gene. If one of these copies contains a harmful mutation, she has roughly an 80% chance of acquiring breast or ovarian cancer in her lifetime.

PCR Activity - Your Task

You and your PI have a tissue sample from a tumor and think you’ve narrowed down the mutation to the third exon in the BRCA II gene. You need to amplify this exon3 fragment so that you can sequence it and find the mutation.

Your task is to design oligonucleotide primers to amplify this exon3 fragment.

PCR Activity - Your Task

Your job is to design oligonucleotide primers to amplify the blue sequence (shown below) through the process of PCR.

We want to be able to capture the entire exon, so you will need to design oligonucleotide sequences that are immediately adjacent to the gene.

The oligonucleotides you design should be 20 bases long.

Here is your sequence:

TGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCT

PCR Activity - PCR Setup

Before viewing the PCR simulation, you need to demonstrate that you understand the PCR process. To Accomplish this:

Drag-and-drop the correct components into the Reaction Tube,
Set selections for each PCR Step (1, 2, 3) of the Thermal Cycler,
Drag-and-drop the blue marker into the gel at the location to indicate a successful PCR.

Once you have accomplished the required tasks, click on the Purchase Primers button at the bottom of the page to buy the required primers. You must accomplish all tasks on this page before advancing to the purchase primers page.

Incorrect - try again.

PCR Activity - Enter Primers

You search around on the web and discover that a good place to order oligos is CDO Biotechnologies. Below is the order form you encounter on their site. Order the appropriate oligos in order to amplify the target sequence (in blue) below.

GCAATTCAGGGCTGAAAGTAAGGTTTCAATTAAGCTAGATGCCTTCTGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCT

Enter Oligo 1:

Cost: $10 You did not include the appropriate number of nucleotides.
Your primer contains non-nucleotide letters.
Enter Oligo 2:

Cost: $10 You did not include the appropriate number of nucleotides.
Your primer contains non-nucleotide letters.

Thank you for purchasing your oligonucleotides from CDO Biotechnologies!

PCR Activity - PCR Results

You receive the primers back from CDO Biotech and use PCR to amplify the original DNA sample. Once that process is finished, you run a gel and get the following result:

In analyzing the gel results, which of the following do you agree with?

Original DNA Strand: TGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCT

Correct Primer:
Correct Primer:

Results

Congratulations! You read the gel correctly and you selected the correct primers, successfully amplifying the BRCA-II gene. Your PI is very pleased...

Click the green button to watch a simulation of the PCR reaction that you successfully implemented!

Original DNA Strand: TGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCT

Correct Primer:
Correct Primer:

You read the gel incorrectly.

Fortunately for your lab, you selected the correct primers and your gel shows that your PCR did work, successfully amplifying the BRCA-II gene. Your PI is very pleased (although she does wish you would get a little better at reading gels)...

Click the green button to watch a simulation of the PCR reaction that you successfully implemented!

Original DNA Strand: TGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCT

Your Primer:
Your Primer:
Correct Primer:
Correct Primer:

Results

You read the gel correctly. Nice job...

Unfortunately, you selected the wrong primers. Your PCR did not amplify the target BRCA-II gene and your PI is not thrilled with the fact that you wasted almost $20 and a bunch of time. Better luck next time...

Hints:

- DNA is complementary.

- The primers need to be adjacent to the target.

- DNA is directional.

- It looks like you may have accidentally entered the same oligo twice. The two primers will most likely have different sequences.

You can, however, view a simulation of the successful PCR reaction you were attempting to run.

Original DNA Strand: TGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCT

Your Primer:
Your Primer:
Correct Primer:
Correct Primer:

Results

You read the gel incorrectly.

Unfortunately, you also selected the wrong primers. Your PCR did not amplify the target BRCA-II gene and your PI is not thrilled with the fact that you wasted $20 dollars and a bunch of time. Better luck next time...

Hints:

- DNA is complementary.

- The primers need to be adjacent to the target.

- DNA is directional.

- It looks like you may have accidentally entered the same oligo twice. The two primers wil most likely have different sequences.

You can, however, view a simulation of the successful PCR reaction you were attempting to run.

PCR Activity - Simulation

Now that you have been viewing PCR, use the selection widget below to show that you haven't been asleep and know the next PCR step?

You were lucky the last time! So you better bring it now. Use the selection widget below to specify the next PCR step?

It seems that you do know PCR! So just one more time use the selection widget below to specify the next PCR step?

How many molecules of DNA would be formed in a 5th cycle? Input your answer in the box below and click on the submit button.

Correct!

Incorrect, answer is 32 or 2⁵

Click on the Indentify Mutation button below to finish the PCR activity.

PCR Activity - Mutation Analysis

Exon 3 of BRCA2 Gene:

PCR Amplified Fragment:

NOTE: Your task on this page is to identify the BRCA2 mutation in your Exon 3 fragment. Fear not you are going to get a lot of help. So keep reading! The blue bar at the top represents the full Exon 3 sequence eventhough the letters are not shown. The slider or handle on the blue bar is a viewing port for fragments the same size as your PCR fragment. As you move the slider handle the current sequence under the view port is shown in the box below the blue bar with red letters to show where there is a match between the Exon 3 fragment and your PCR fragment. So to accomplish you task of finding the BRCA2 mutation you move the view port left or right until you see a sequece wilth all red letters except for one (also the blue bar turns light red). At this point stop moving the view port, and click on the mutation in the PCR Amplified Fragment box. Hint: slide slowly and watch carefully!