recap

14.5 recap

A key step in protein synthesis is the attachment of an amino acid to its proper tRNA, which is facilitated by a family of specific activating enzymes called aminoacyl-tRNA synthetases. Translation of the genetic information from mRNA into protein occurs at the ribosome in three stages: initiation, elongation, and termination. Multiple ribosomes may act on a single mRNA to make multiple copies of the protein that it encodes.

learning outcomes

You should be able to:

  • Describe the process of translation.

  • Translate a sequence of DNA into a peptide.

  • Explain the biological significance of polysomes.

1.

What are the roles of rRNA molecules in the ribosome?

rRNA acts as a scaffold for proteins to make the ribosome structure, with binding sites for tRNA. An rRNA has a nucleotide sequence region complementary to a region on mRNA so the two RNAs can bind and begin translation. An rRNA acts as the catalyst for peptide bond formation.

2.

Given the DNA sequence:

5′-ATGCCCGGGTTAAGATATTTTAAATGA-3′,

  1. write out the sequence of the complementary DNA strand.

  2. indicate which strand is used as a templare for transcription (and how you know this).

  3. write out the sequence of the transcribed mRNA, and provide the amino acid sequence of the translated peptide.

  1. 3′TACGGGCCCAATTCTTAAAATTTTACT-5′
  2. The bottom strand is transcribed: It has sequences that are transcribed into start (AUG) and stop (UGA) codons in RNA
  3. mRNA: AUGCCCGGGUUAAGAUAUUUUAAAUGA; Polypeptide: met-pro-gly-leu-arg-tyr-phe-lys

3.

What are the structure and significance of a polysome?

A polysome is formed when more than one ribosome is bound to mRNA at the same time. This can occur because ribosomes move along mRNA is a 5′- to 3′ direction, translating as they go, much like a cafeteria line. Polysomes allow more proteins to be made at a given time from an mRNA.

The polypeptide chain that is released from the ribosome is not necessarily a functional protein. Let’s look at some of the posttranslational changes that can affect the fate and function of a polypeptide.