APPLICATION QUESTIONS AND PROBLEMS

Section 11.1

Question 12

*12.Assume that the number of different types of bases in RNA is four. What would be the minimum codon size (number of nucleotides) required to specify all amino acids if the number of different types of amino acids in proteins were (a) 2, (b) 8, (c) 17, (d) 45, (e) 75?

Question 13

*13.How many codons would be possible in a triplet code if only three bases (A, C, and U) were used?

Question 14

14.Using the genetic code presented in Figure 11.5, indicate which amino acid is encoded by each of the following mRNA codons.

  1. 5′—CCC—3′

  2. 5′—UUG—3′

  3. 5′—CUG—3′

  4. 5′—AGA—5′

  5. 5′—UAA—3′

Question 15

*15.Referring to the genetic code presented in Figure 11.5, give the amino acids specified by the following bacterial mRNA sequences, and indicate the amino and carboxyl ends of the polypeptide produced. Hint: Remember that AUG is the initiation codon.

  1. 5′—AUGUUUAAAUUUAAAUUUUGA—3′

  2. 5′—AGGGAAAUCAGAUGUAUAUAUAUAUAUGA—3′

  3. 5′—UUUGGAUUGAGUGAAACGAUGGAUGAAAGAUUUCUCGCUUGA—3′

  4. 5′—GUACUAAGGAGGUUGUAUGGGUUAGGGGACAUCAUUUUGA—3′

Question 16

16.A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence?

5′—ATGATACTAAGGCCC—3′

Question 17

*17.The following amino acid sequence is found in a tripeptide: Met-Trp-His. Give all possible nucleotide sequences on the mRNA, on the template strand of DNA, and on the nontemplate strand of DNA that can encode this tripeptide.

Question 18

18.How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence Met-Leu-Arg? (Be sure to include the stop codon.)

Question 19

19.The following anticodons are found in a series of tRNAs. Refer to the genetic code in Figure 11.5 and give the amino acid carried by each of these tRNAs.

  1. 5′—GUA—3′

  2. 5′—AUU—3′

  3. 5′—GGU—3′

  4. 5′—CCU—3′

Question 20

20.Which of the following amino acid changes could result from a mutation that changed a single base? For each change that could result from the alteration of a single base, determine which position of the codon (first, second, or third nucleotide) in the mRNA must be altered for the change to result.

  1. Leu → Gln

  2. Phe → Ser

  3. Phe → Ile

  4. Pro → Ala

  5. Asn → Lys

  6. Ile → Asn

Section 11.2

Question 21

*21.Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis:

70S initiation complex

30S initiation complex

Release factor 1

Elongation factor Tu

Initiation factor 3

Elongation factor G

fMet-tRNAfMet

306

Question 22

22.The following diagram illustrates a step in the process of translation. Identify the following elements on the diagram.

image

  1. 5′ and 3′ ends of the mRNA

  2. A, P, and E sites

  3. Start codon

  4. Stop codon

  5. Amino and carboxyl ends of the newly synthesized polypeptide chain

  6. Approximate location of the next peptide bond that will be formed

  7. Place on the ribosome where release factor 1 will bind

Question 23

23.Refer to the diagram in Problem 22 to answer the following questions.

  1. What will be the anticodon of the next tRNA added to the A site of the ribosome?

  2. What will be the next amino acid added to the growing polypeptide chain?

Question 24

*24.A synthetic mRNA added to a cell-free protein-­synthesizing system produces a peptide with the following amino acid sequence: Met-Pro-Ile-Ser-Ala. What would be the effect on translation if the following components were omitted from the cell-free protein-synthesizing system? What, if any, type of protein would be produced? Explain your reasoning.

  1. Initiation factor 3

  2. Initiation factor 2

  3. Elongation factor Tu

  4. Elongation factor G

  5. Release factors RF-1, RF-2, and RF-3

  6. ATP

  7. GTP

Question 25

25.For each of the sequences in the following table, place a check mark in the appropriate space to indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence).

Process most immediately affected by deletion
Sequence deleted Replication Transcription RNA processing Translation
a. ori site ______ ______ ______ ______
b. 3′ splice-site consensus ______ ______ ______ ______
c. Poly(A) tail ______ ______ ______ ______
d. Terminator ______ ______ ______ ______
e. Start codon ______ ______ ______ ______
f. −10 consensus ______ ______ ______ ______
g. Shine– Dalgarno ______ ______ ______ ______

Question 26

26.Give the amino acid sequence of the protein encoded by the mRNA in Figure 11.13.