CHAPTER 7 Test Your Knowledge

DRIVING QUESTION 1

By answering the questions below and studying Infographics 7.1 and 7.2, you should be able to generate an answer for the broader Driving Question above.

KNOW IT

Which of the following is not a nucleotide found in DNA?

a. adenine (A)

b. thymine (T)

c. cytosine (C)

d. guanine (G)

e. uracil (U)

If the sequence of one strand of DNA is AGTCTAGC, what is the sequence of the complementary strand?

a. AGTCTAGC

b. CGATCTGA

c. TCAGATCG

d. GTCGACGC

e. GCTAGACT

In addition to the base, what are the other components of a nucleotide?

a. sugar and polymerase

b. phosphate and sugar

c. phosphate and polymerase

d. phosphate and helix

e. helix and sugar

The_______chromosomes in a human cell from inside the cheek are found in the_____.

a. 46; cytoplasm

b. 23; nucleus

c. 24; cytoplasm

d. 46; nucleus

e. 22; nucleus

Each chromosome contains

a. DNA only.

b. proteins only.

c. DNA and proteins.

d. the same number of genes and STRs.

e. the entire genome of a cell.

USE IT

You can detect DNA that is specifically from the x chromosome in a DNA sample from a person. Can you definitively determine the sex of that person (male or female) from the presence of the x chromosome? Explain your answer.

Human red blood cells are enucleated (that is, they do not have nuclei). Is it possible to isolate DNA from red blood cells? Why or why not?

DRIVING QUESTION 2

By answering the questions below and studying Infographics 7.3 and 7.4, you should be able to generate an answer for the broader Driving Question above.

KNOW IT

DNA replication is said to be semiconservative because a newly replicated, double-stranded DNA molecules consists of

a. two old strands.

b. two new strands.

c. one old strand and one new strand.

d. two strands, each with a mixture of old and new DNA.

e. any of the above, depending on the cell type

Which of the following statements about PCR is true?

a. DNA polymerase is the enzyme that copies DNA in PCR.

b. Primers are not necessary for PCR.

c. PCR does not require nucleotides.

d. PCR does not generate a complementary DNA strand.

e. PCR can make only a few copies of a DNA molecule.

USE IT

Complete the statements below, and then number them to indicate the order of these two major steps necessary to copy a DNA sequence during PCR.
_______The enzyme________”reads” each template strand and adds complementary nucleotides to make a new strand.
_______The two original strands of the DNA molecule can be separated by_________.

Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication:
ATCGGCTAGCTACGGCTATTTACGGCATAT
TAGCCGATCGATGCCGATAAATGCCGTATA

DRIVING QUESTION 3

By answering the questions below and studying Infographics 7.5, 7.6, and 7.7, you should be able to generate an answer for the broader Driving Question above.

KNOW IT

Which STR will have migrated farthest through an electrophoresis gel?

a. GAAG repeated twice

b. GAAG repeated three times

c. AGCT repeated five times

d. GAAG repeated seven times

e. AGCT repeated seven times

An individual’s STR may vary from the same STR of another individual by

a. the order of nucleotides.

b. the specific bases present.

c. the specific chromosomal location of the STR.

d. the number of times a particular sequence is repeated.

e. the number of coding regions.

Which of the following represents genetic variation between individuals?

a. whether or not G pairs with C or T

b. the presence of STRs in their genomes

c. the number of chromosomes in the nucleus

d. the sequence of nucleotides along the length of each chromosome

e. the number of chromosomes received from each parent

A person has an STR with the sequence GACCT repeated six times on one chromosome and eight times on the other chromosome. If this STR were amplified by PCR, and the PCR products run on a gel, which lane would show the corresponding banding pattern (see gel at top right)? The marker lane (M) has fragments starting at 10 nucleotides (at the bottom) and increasing in 10-nucleotide increments.

USE IT

A series of statements is presented below. Mark each statement as true (T) or false (F).

a. ______ G pairs with T

b. _______ Genetic information is passed on to the next generation in the form of DNA molecules.

c. _____ All DNA sequences encode information to produce proteins.

d. _____ Each person carries the same number of STR repeats on both maternal and paternal chromosomes.

e. ______ DNA evidence can be obtained from saliva left in a bite mark.

Explain why the statements that you marked as true in Question 16 are in fact true.

Rewrite the statements that you marked as false in Question 16 to make them true.

DRIVING QUESTION 4

By answering the questions below and studying Infographics 7.1, 7.5, 7.6, and 7.7, you should be able to generate an answer for the broader Driving Question above.

KNOW IT

The gel below shows the DNA profile of STRs from four sources: blood from crime scene evidence (E), suspect A, suspect B, and the victim (v). An eyewitness identified suspect A as fleeing the apartment building where the crime occurred. Suspect B was picked up at a local convenience store after using bloodstained money.

a. From the DNA profiles shown, can you draw any conclusions about where the crime scene DNA came from?

b. Can you draw any conclusions about relationships among the people profiled? Explain your reasoning.

USE IT

Look at Infographic 7.7. From the STRs used in forensic investigations, which STRs on which chromosomes would be particularly useful in determining whether crime scene evidence was left by a female or a male?

Explain your response to Question 20, stating the number of STR copies you would expect to see if the perpetrator was female and if the perpetrator was male.

The gel below shows a DNA profile using five STRs. The lane labeled W is a mother and the lane labeled C is her child. The lanes labeled M1 and M2 are two men, either of whom, according to the mother, could be the father of the child.

a. Circle the STR bands that the child (C) inherited from its mother (W).

b. Use the DNA profiles to determine which man is the father of the child.