Chapter 7. DNA Structure and Replication

7.1 Introduction

Interactive Study Guide

false

true

Welcome to the Interactive Study Guide for Chapter 7: DNA Structure and Replication! This Study Guide will help you master your understanding of the chapter's Driving Questions, using interactive Infographics and activities, as well as targeted assessment questions. Click "Next" to get started, or select a Driving Question from the drop-down menu to the right.

Biologically Unique:

How DNA helped free an innocent man

DRIVING QUESTIONS

What is the structure of DNA and how is DNA organized in cells?
How is DNA copied in living cells and how can DNA be amplified for forensics?
How does DNA profiling make use of genetic variation in DNA sequences?
How does DNA evidence fit into forensic investigations?

7.2 Driving Question 1

Driving Question 1

What is the structure of DNA, and how is DNA organized in cells?

Why should you care?

DNA is the hereditary molecule—passed from parents to offspring—that serves as the instruction manual for building each individual. DNA is found in the nucleus of almost every cell in our body. Forensic scientists can therefore collect DNA evidence from many types of crime scene evidence, such as semen, saliva, skin cells, blood, and hair. This DNA can then be used to positively identify a perpetrator or exonerate accused suspects of a crime.

Roy Brown was convicted by junk science; the only “evidence” linking him to the crime was his teeth, and bite mark analysis is notoriously unreliable. Other types of physical evidence, such as hair samples examined under a microscope, are also problematic, as they are not distinctive enough to positively identify the individual from whom they come. DNA is valuable in forensics because it is unique to each individual. DNA’s structure is the key to its uniqueness in each individual.

What should you know?

To fully answer this Driving Question, you should be able to:

Understand and describe the origin and function of DNA.
Describe the location of DNA in eukaryotic cells.
Understand and describe the structure of chromosomes.
Understand and describe the number and origin of the chromosomes in human cells.
Understand and describe the four types of DNA nucleotides and their basic structure.
Understand and describe how nucleotides are linked to form individual DNA strands.
Understand and describe how two DNA strands are bonded to form a double helix.
Understand and describe which feature of DNA varies among individuals, making each of us unique.

Infographic Focus

The infographics most pertinent to the Driving Question are 7.1 and 7.2.

Question Test Your Vocabulary

Choose the correct term for each of the following definitions:

Term	Definition
SUuZ/pyqGso/14KJ/EG8xB70qB8/4QLH/Dzd5WdnM6dlrBYIbwmyir3eLDdr/sIYgYhV15wDTQawNrgQjbjQZyHSOLb05wnjJOcbiN98b4R0xE1S	The spiral structure formed by two strands of DNA nucleotides bound together.
ot1sB16sFJVMWRtAVZ4pw+qITHxpwV32zTyKbbKjocEn5Pfq1hcu5ukb5XQzKLjtYyKrcgKrTVpsYV1HQOurqsDdQ6Qyxij4VAnrlJ+I2S/7afBx	The building blocks of DNA. Each nucleotide consists of a sugar, a phosphate, and a base. The sequence of nucleotides (As, Cs, Gs, Ts) along a DNA strand is unique to each person.
lVTw7rMpaimS5fPfKwTkMUsIoIFm4RK2PEsXwnfUw9MAxEg0EV4b1iqP2v1TzAKHD8Tas5ravv+md+BpafQ/2K8BCTCJ1pO6oRtXC3u6QWU127vP	The molecule of heredity, common to all life forms, that is passed from parents to offspring.
9EdaE5bXsz+tVKnutW9hXE6Q79FZ94DVGLWqnHF6v4qmIEDu2/8oUCZXFroTckTxAxWOfUJgM6lF7LspzMoHORY3aURMCGDrIdX8LeKVo5XajtPE	A single large DNA molecule wrapped around proteins. Chromosomes are located in the nuclei of most eukaryotic cells.
AAZDbJ3CYVmL4zg6zLuZFZmMxQkXeVv/j+eAscdkQDZI8z7lQI5pzZk0RTsnnxqtMmBFRZaltSYgR9rvuHi3YZNoTq71+BuIregY2HUGKxEXHJXJ	Fitting together; two strands of DNA are said to be complementary in that A always pairs with T and G always pairs with C.

Table

Try again.

Correct.

Incorrect.

Understand and describe the origin and function of DNA.

Question 7.1

VVoTi8xepJ0ALpIwLyy9r/2xIDvSLoMF9yNf319VxlEnJYJz

You inherit half of your DNA from your mother and half from your father (23 chromosomes from each).

Question 7.2

vdc1Sls72lH508IzFpexmcPT2cFhvDzmVcj9O+6xWacmveykpAS3rnLySJzDjpNtxRNCqWCbjFkAJ6Yz9BgxKK2MMGzpggLM

The DNA in a cell is like a set of instructions. It has the information to make any protein in your body and provides the cell with instructions on how to develop and function.

Describe the location of DNA in the cell.

Question 7.3

d3eA/peBCl+zqpqpeXUrDT+7UP4zeQXrCbjqRpEfYYyQaNUACK6YsGQe2vqhGebcvLQ2vvH41F3hFzesJX8m6h6oSgcJZzJYELFYFSd50LgyfgBadlBbDEFqh9Q+8L1Hb9jlfR53oAIjFEGVldxVA1+5Dg7I21IcgitcPatJ87Wa77bhNXHLrXuBaSDrW3VfsUlL8ZtyN1CLK22MjfkcZbMmGHq7064c+WEknPE4BUm33k1w

DNA is inside the nucleus of cells, where proteins necessary to read and express the DNA are housed. The nucleus of the cell is called the control center, as the commands for cell growth and function typically come from within this organelle. DNA, however, is the element that is making the actual commands.

Understand and describe the structure of chromosomes.

Question 7.4

51SbA1IDDWvlJ5iDCZ0iahX5G75Rds9zGyLiyGRq1LkrguaFH2w1ZKfxGEZjOMan4CgjxXJtH2fLUkYWPSd7pEFWYktQbVuwtz6TzDykcvSZkBQez+mSCGMHMZid2we3W9dc33Y4pndqgzbWxmRXpcPxaiI=

DNA and proteins

Question 7.5

nUS7YA0Pu6cknx916BFwyx6ShZjP5npLtooC2KkQDmmOKT4lIXLHOxyhPh90kvb0j9u75euhUV1NyEyglo3VROFBje437F8zDRjfxQ==

Long strands of DNA are wrapped around the proteins to condense the DNA so it will fit inside the nucleus of the cell.

Understand and describe the number and origin of the chromosomes in human cells.

Question 7.6

NAqxhPblNj15k6yV64Eo2ZD3/GYCxVuhJWlws9OuKQDzArnmjv6Hz0ioHh2d49TKw19nd1BUwPKztICjhOCx1RZ8NbMBVQJjOCBrB6ndlXqQHhFgx96pIzJ1tNFif2fWzA2M6PBS6xKSClnd8u+3Bwe3inGc0T7j0tovP2Q138qI9PjgYzxeez7RuSyFUFNN1LfPoS83OAfxZ7Vy+us+0jMn9mA=

Question 7.7

7+SVYYePO/mdChLLyQ7BQ9OfHKReG61qFrNyRC90/MMewe059LU4sYpFcMySpd1A7G25VVVoCfAYDg49eoup4q9IniKfw8Xj5JDyOjgMsWUUEajeHrtax5Fa8i7pFyThO6uMqf0IyJpM5gdOjZkKckY2p2+WMzUlkR45rhYQ+FgDk/AgVahBgdImjxNe0kXdVSE6YQ==

One comes from the mother and the other comes from the father.

Understand and describe the types of nucleotides and their structure.

Question 7.8

bnyxnLt5EEafmDmuRmhkMgpaX+z8Dn80P7rAVfEvqeaK/h9vn9rpeluqJOhZh8ydPBRAq9ZJftILwMB4fn3G2K8okwXtx6w5S84O4286+QzM7aAYjg7FFPindY1O+5Da

The three parts of a nucleotide are a phosphate, a sugar, and a base.

Question 7.9

8dyeV3jueYxdfaVynnU/O1+X2DOYFC8yk13yqnj5TTQadRicuVm07O+BDn7U1ce7qEcvqgJIuLRtArIZHM3hBjgkvLhVETq7PacnCbLt0y8L+G0rBpa5s3czl7FyzSuJgXEl7ghxbbpmxRhs8d0v1GhQB5fNR1aN+lIYl/d48nAFuwf8cOiGfRdBVGRqlV4xAocQbb8/mEpEKc9e6GgAOgdR6uBVjGACEXyImy329MXeujN6V3KUnIwl7uLwH5HnoGkQfquKfHDiVPhYg/H03tJfDA25B4TwyqdrEA==

Their bases.

Question 7.10

fZAar8xYccOtOBMoYnVmy9hkwA+IvOSEitqIyoZTadw6oIHD/i6kexcNmffGGtczLUadKWMuvo8GiRr0K3ocUwy0BqConlwFmhrwIFCP5o4=

Adenine (A), Thymine (T), Guanine (G) and Cytosine (C).

Understand and describe how nucleotides are linked to form individual DNA strands.

Question 7.11

HObbKD/UW1TXUzwMxw+Dr8HYTrP/f9pEYMN21GH0KjioaACINTINmzMI0quEzZfYlQA+Bjtso0puy1wzi4zTeamU18LeWZxrcocg2W8KCYL1UudQcIS1lrDeFin1ue/GoIKBOi/KP005LUbuwa5laUNHC4riSikZEzuZTSwys/d/9VnQ3+Qtm0U5l3P48XX4GRGAlw9F4yKFyiNBe7zhhSirdYImdUJCJdUROLKmuHi5KxsUoG+Y8A9KXuyLdXViwN33MS5UQkjCxETLhAG5LmPV5nTlA0xNuddwQJyJ3dk=

The phosphate and sugar components

Question 7.12

CrBw/GlfV+Bwh2EbyAtEmqgST4+pEzEeH+UVUe4BJHINLj8tzqX6SZ/gGF4MQnb7sTvG7nCa84Of+IFV1uc4fFNvcyzITdjL6nIowJi050dXY1HkWhIKYIxn4WMDpi08eUAlCegxwz/cVbEycWjhGn4vFWxfydD15tRjbtlX97khYVKphwOBHNiM1Vn1gJ+Ja5mOJ0DptVrMcSqmc+8NrxQaQUkaAfeZpQp55B7Z8iiAqmFaMWjeulLrWo578D0P6Pjscl4i6rPe5m3jmdfBkxMT+M8oiBx4Sa3ne1QkpGddWcMkdwJCmnZdYGlCBslcTYOCiOQItxKDCFVVTt+iYiRTNfsK++GT3pRsfXAgLDVUaEoPxbk/i2Z/OR8DfYxusOw68jdGqXvMVXIDOcr0b2Qf+AzJPfjoReUwYg==

Covalent bonds are relatively strong and thus hold the strand of nucleotides together. If this bond were weak, the DNA would break and would likely not function.

Understand and describe how two DNA strands are bonded to form a double helix.

Question 7.13

a3XCsOHYl6WZvMJX46FxG+i7ARisObupF/rV0OuD7OcZVOosJSH+rrZ55MLzNzX4BqXKydNz1ZNN58Dy36Pb3uthxsGFsI1cRCU/SR3owS5q+4JM

the bases

Question 7.14

f2BR/03N/JPXg7e9lvFUpApqCJc4O2+XhaWahZQRyf59jR++N2miUj+V7TiTzJQPxZrHxV5xSVgV6UiV8Re+Uss6CsX+9buXC3po5Rk4qYspRNI1qktlIs5zgpaRTKku

Hydrogen bonds between the bases hold the two strands together.

Question 7.15

HRrECcDFOfdoSy6Pa6l4UNUK7v6agOq0s+1WMVbIjZqDu6ULkXrX4DpGmLCE2zCBaMqyAMwR2YOtpdWQSRJ9v+H+Eu4/kaLw2aIAnkqQFbmjnFohLN1CreScl/fiNz9TfoyxUAvBhfVA7106OFAQiOAbZTXW1UZ4P4keaGZdSQMpESMbm+vOgYz44niKRksa

Hydrogen bonds are relatively weak compared to covalent bonds.

Question 7.16

Here is a list of the abbreviations for the four nucleotides in DNA. According to the rules of complementary pairing, write next to each one the abbreviation of the nucleotide to which it can bond on the opposite strand to create a rung linking two DNA strands:

A5C7cijcTSrFYDmxzHDF/iTM5C+i5JSHYH8Z+bh6gYjC5dFjahyX69w==

Ts6CYR6SO7lkTGHQj6GPd8A==

G+k8133qSNYgQkLvGjG3jeg==

CXfUw05ND1SVzADPjDKguMA==

Correct.

Incorrect.

Understand and describe which feature of DNA varies among individuals, making each of us unique.

EChvduL8C0zfs23zyIe9F46r2cM+AyRV6tmpluzHphylu12zla6kbZ2rOoyWcc8lOR5wvPfSu50DaZtAhHHE/1caJ3+3TnyzHr+gosJ+RLp/dkPjTSLaq0DLcjAeyrhM8r3758oE2vAHwFmZz+Sj9NQTuR3x5pcDTBfyQWQYHJ/Xnx7tGidS9hn6ihUxiedKyhyKvSTZUFPi8/7U8Wu6R4Vv+ItCY7Abtb6r6U0IhaYVVypwXDhxdyzT7ZyotzPFQuQI3vvHfAf9o6IJ5H1Ucg5Gsb6dE5RcVrkn5yYVrZVIg4eNRYC6COiWX9+LEEhIgRpeCfImSFLiuLZInBO1aivbvoQK1E8seJuDVBLquYAWcR65BsjaW8GUNCklVBefbluvAYplMPD4d4I5dTcwtoz5oMKfhJzE7GsUq8Q9mUVigMYVGaVPtnmZ+d3PDJA5ffk3zUJsFEODbX0aLHoze9dBslmrzmN5W6Lzh2mGesjJ9vp4nR+2TdoaX7O7wlezF8Wc+5TYlFCxjE7Oat8lbPpcn+7PRWaQR8Oss6k3dlVhkMiZzRPIO6VMUt8+56FzXStq71wHe7JRukm67wPYDlefEBDk3tToblLKdM/rRl1sVQ37TeICZFvduT5wAylCAlpNpvJV3r+Q1udrpnS4ivYMHW0G6ssSC7deyoURDljPfwetGVqel0xUyswEL/N1UVACwOfOtFW1nssXS/Jvqg==

Try again.

Correct.

Incorrect.

Related Vocabulary

Question 7.23

Hg4tcbjCp4geqRi+DJ/Oj5FyIftOq6DNkngdJfpdC89zDlmM6VDzRVJY2W7jv2KZci007oUnZRBZunrqDvFVQAXpzfqCuVen1qiYEkBqpq121OpBzgyDSa8demfrsS0c9O4FOc2dHJmeXhNXu/Gi5XkJ+RAR2IpcC4AxNUzoVd0pSO28KyN3sBsVFTkG+ZyX

7.3 Driving Question 2

Driving Question 2

How is DNA copied in living cells, and how can DNA be amplified for forensics?

Why should you care?

A major problem with building DNA profiles from crime scene evidence is that crime scene evidence often does not provide enough DNA for analysis. In Roy Brown’s case, for example, the only DNA evidence came from bloodstains and saliva on the victim’s nightshirt. Chemist Kary Mullis developed a method to overcome this challenge. The polymerase chain reaction (PCR) takes advantage of DNA’s natural replication mechanism to amplify (multiply) tiny amounts of crime scene DNA into quantities large enough for analysis. The structure of DNA is the key to its natural replication mechanism.

What should you know?

To fully answer this Driving Question, you should be able to:

Understand and describe the role of natural DNA replication in living cells.
Understand and describe the basic steps of DNA replication.
Understand and describe the role of the enzyme DNA polymerase in DNA replication.
Understand and describe the composition of the two newly made DNA double helices with respect to the two strands in the original DNA molecule.
Understand and explain the similarities and differences between PCR and DNA replication.
Understand and describe the steps of PCR.
Understand and explain how PCR produces large amounts of DNA very rapidly.

Infographic Focus

The infographics most pertinent to the Driving Question are 7.3 and 7.4.

Question Test Your Vocabulary

Choose the correct term for each of the following definitions:

Term	Definition
tnLs6sO9WdoOIGB42vdkhSOi+ST9Xetq4BN2BGpkocyJxrFOkl5maAr4yigPVIZvXIBCA/TRRtO1pp4GpSz7dFpx1miuxz0sbVQSCAtQVbBTLGtRWEF7JjMHkt0aASSkKkRgMg==	Fitting together; two strands of DNA are said to be complementary in that A always pairs with T and G always pairs with C.
sgaIkT28MqngpSjrZmPpBpvToroff8RW6OfYpBnOWhmrT7sFFYKnTgTKxTFZWrzcr1En05oSSKZSesltexuAjZWgfp3iZN5azdgTOfbeeI3eDkd4QuX3Ia+joNg+8vX9CK/87A==	A laboratory technique used to replicate, and thus amplify a specific DNA segment.
AWXLV/kpgA8zRsvGTma0IhxTHig3pW3Ey5y4qC+cXDyNV4UffUw+n8Kq6dR/S48QpOlnsLBne6nl4ygLniQuL21lxrDRC52lPyvzY2W1dtQDC4CRSMXxOXH2Gr1gvWwz99XJnw==	The natural process by which cells make an identical copy of a DNA molecule.
851/oP9JHFSkSJXIibFba4dqjHdIEg2fDZOkV//hWx2tUokPr76puTI3tcrJ3klDXhmSzl6qap7r8+zKb64sgISYjo0ecbc1mn4VsN58lyQeFbyNlS/oTq9CMDDKsTRIgP0tgg==	DNA replication is said to be semiconservative because each newly made DNA molecule has one original and one new strand of DNA.
CiFCofKrdC69/MPOThJ3cCgmz6ppmg1LQKgAHZMsBxOvnTgiYRhpJp+FMEcM3fhqgk3kTGucPQaKhdlnPPq3N6jqSnGeI//ZsjuyjD6eSc55Fz+YymCqUPAuUDH74kQAd6QpTw==	An enzyme that reads the sequence of a DNA strand and helps to add complementary nucleotides to form a new strand during DNA replication.

Table

Try again.

Correct.

Incorrect.

Understand and describe the role of natural DNA replication in cells and organisms.

Question 7.24

W3CaVnl62Te9vi04Pp3TwZKPjI5lP+Lty2+wK8aWNcLKKYEMs9FDRfuwPsa9hStEbfzsHDNIUSPaGeDxyIk4HA==

Cells must replicate their DNA before they reproduce because otherwise the only one of the cells resulting from the division (daughter cells) would contain a full genome.

Question 7.25

8p2PGv608W0FSBPd/R8OHXYiSrICnuCFjGXjHmxRCd/r5mVdJwSENxwqljTVeQiEhhTAXC0Qkdvy/ZIe0RQbeCfsDJI=

Cells in the body must reproduce to repair damage and replace old and nonfunctional cells and for growth.

Understand and describe the basic steps of DNA replication.

Question 7.26

QXw0leXaEl7F7qveqSMZXGutkFEQOCazpMluli1VONm75IkXbEkXyWFY6Tn1k/AuAUH2isojMiBov+u1T1ginMIbH+2MtvV/

(1) The DNA unzips by breaking the hydrogen bonds between the base pairs of the two strands. (2) DNA polymerase attaches to one strand, reads the nucleotide sequence, and adds complementary new nucleotides to the growing strand.

Understand and describe the role of DNA polymerase in DNA replication.

Question 7.27

FZVz7mgLchPFV7G5hce+mI28kZn4KAkJmU4PNSTdz3U1ZZzZeGvNMz7B3cWyzA8F/SIZGdk1oFo=

DNA polymerase reads the DNA strand and adds complementary nucleotides to the growing new strand.

Question 7.28

uxqFSPcKdGp0g+Wo2j7+j9VMiKBuZrWvgI9mhRT+lylirDbMV42xd82eMqPFxR+pkCzYu6Gn9SQ8ed3VmrtpLrhoiDhfC8tfb1X9bDOD5QkS3EiCVaWLL9pryDrTmC/ZOAnymXdM257hlIDgl5Ubom5eJ96GW4xBWKFGpg==

DNA polymerase uses the rules of complementary base pairing to pair an A with a T and a G with a C. This complementary pairing is important because it ensures that the sequence of nucleotides in the DNA remains the same, thus coding for the same proteins.

Understand and describe the composition of the two new DNA double helices with respect to the two original DNA strands.

Question 7.29

GA6ICxOxl2bNdXlArZ7aDZgBH8gHN3/LeqiM3zgpzyrPQupgDlTuEQhCLzDPN0m8hMBClO11+benp7IMf62LrykkPvpe042ET8n+NJZe4kjXwq1euoLl4PYHoqezCNrwwO1GcsxbhZKBROg6aNQjXSmnNQBn1x6HDlIoW2xUieHcoeNw8p67hJtVQvV73u0yJ8RXj0uBvz2654UMDD70umBW0tcItclI0MHEszP4MRb1SNHAWdAdhpPu/I4GxgILlZ0nTDkb2KZmG6cq444E7rGE/GjCj/u2FjqXiVObFNc=

Two strands make up the original DNA molecule prior to replication. Four strands (two DNA molecules) are present after DNA replication.

Question 7.30

nWNOCkdtgHTTgsF2UHPLoK8S2IK4slrkOexqWIbUAFPcueYX+ia2H44KOXcVMHIQLATae9EFY3VOwW/qvwl0OeplqwV+LZKwJEBWZzt6XjA6Du5GQy14uEun4XHWSMyUJRS3+Yxw8J8iQ76jN3YD08j1AkGGK6AQMgEzpWSTi5oOiofmg97mt9JRYBeekCan3XdcvXcgAdKNYlC/IjuaI3Jh5R+aWT8cpxmIcoHKXJgMTz+W8Ge48A==

The daughter molecules are made up of one original DNA strand and one newly synthesized DNA strand. Another way to say that would be to say that the daughter strands are semiconserved. The sequences of the original DNA molecule and the newly synthesized molecules are identical.

Understand and explain the similarities and differences between PCR and DNA replication.

Question 7.31

L/Y2ejSnvDo/zMw5h9wn6BUB210ejh7ziw7aDdV5DuG8h/PwyQZLKFlCC7ct7DpMGfLZCsUNibzKF4/WEnfsnFyjarCKdbH8v074V2/n0wZ3B5hrxPY0p8r3xEzFHQqgl3ueEvKDF5jsxD85+q0oZEfp+oBSmLlp7XZzJmHnKYoFzNThwWnyw2wQYmVcyCYvCeFKt8Pc57yqzIl2eRPq1OXABSPqxH0y

PCR amplification and DNA replication are similar in that they both involve separating the parent (or template) DNA strands and using DNA polymerase to add new complementary base pairs to the growing strand. In both cases the result is two daughter molecules of DNA that contain one strand of the template DNA and one strand of the newly synthesized DNA.

Question 7.32

1Qq1tW9zMod3sr8fPFVp7dA96aadTl9ZRr77/XiHQn6BYVtdTm8JrTo0XXcyD+r0kVwE++83ajaUiEymkkNhUnJBBtYY74yS

First, PCR occurs in a test tube (not a cell), and it amplifies only a specific region of DNA (not the whole chromosome). Also, instead of enzymes separating the template strand for replication, PCR uses heat to separate the strands.

Understand and describe the steps of PCR.

Question 7.33

CDKpolxB+TJZ/X2KYFaR+bJ/89TxLGJnEa1gGEcos/PCHl3ME0JKJORFkpAix/WayLSm/S5BcfrX/xhFc+zw8SpEITo/08qDZ3WQ8g==

The following components are necessary for PCR: (1) Template DNA strand: this is the DNA that will be replicated. (2) Primers: these are short lengths of nucleotides that bind to a specific region of DNA and tell the DNA polymerase where to start replicating. (3) DNA polymerase: the enzyme that reads the template strand and adds new complementary base pairs to the growing strand. (4) Nucleotides: As, Cs, Gs, and Ts are added as material for the DNA polymerase to use to build the new strands.

Question 7.34

ji0p6ao0gwykw8zswRapvDH0TdnHWJdbp/hB1TOrSBwfpKFISXiYy8cCr7+Kf7ukfJ3IQM4XuJbIRrQABlWlqEIyt8huZqlYLFdWlepIrk6G+dXSqApHc4YjbDm4S6/4hEVpbrrDGMfYR3WO0GP21w==

(1) All starting materials are added to the tube. (2) DNA is heated to cause it to separate. (3) Primers bind to the complementary region of DNA and act as a flag for the DNA polymerase to come and bind. (4) DNA polymerase binds to the primer, or template, DNA and starts replicating the DNA. (5) Once the DNA polymerase stops replicating, it dissociates from the template strand. (6) The tube is cooled and the DNA strands come together and bind, one template strand with one newly synthesized strand. Now the process is ready to begin again.

Understand and explain how PCR produces large amounts of DNA very rapidly.

Question 7.35

hbT6d5u7MXsMP2R2RF646ZneLPFmUNA7SPAQtNCp+k5GUHbtEbsky/n2c5YJhBe3we7t2oVUD9Txn9wZVEUB9SC0mm55wtA7v5TF91Tq8OJBKnV4iw3rEbsPcwn12RIxB4CV/gbuYSZuxHW27sjj3U96NQSBOs9Dtqikb6s5ugr0mgHUBdrhm2iFrlW5jPaB2NkwwFljDVpgt97mJClpKWpL+eg5ipVs/AMB8lpxXHYgl0Yzy0i/IkiBErMZVaUHFBhoHA==

PCR can produce a large amount of DNA quickly because it is an exponential process. Let’s say you start with one template of DNA. After one round of PCR, the template becomes two molecules of DNA. Now you have two templates in the tube. After the next round of PCR, each template becomes two again, totaling four molecules of DNA. Four templates become eight, eight templates become 16, and so on.

Review Questions

Question 7.36

hXKLn8ZjJoAegh2/6L4pZmHcDRVgQ17/diMJbs65Avg9lDMSBvUnWf+K+YxPDkltrui/GSDtx19lWWNolyoztxQtcZdT0aF34VVGr+jIYhRIWOp0bzvLznx+0L+uLqOyq4ZpHN58Vl35xcq/md+EN6uD220g6fhBG/vyLBrDNo6weTre89OXh+ktwJJF5CP0RE9ABlObyGhx44qGk7czUcQAKwkDB5BPsdkMOLQa7LYCEOeDvlxMrlMYMbUDG98xTSTsM+hxXq6Y5rXJeQYnB8VxQRjNcA5ZZsUcsEGWDZ8jGSDsxxaOEbPZ/3Vj6UXeN+L7AmJETDk1wd7a+5ZuNhUwOZo1jjYbLXFEtH15peo2IXe0ESuP+ILyxbiQDLb8OIYdBoN98mrt6I8tksrkg3c2Y6JAGinmH7QmGsFPeTSU5zqiDA9ZVuyi5A8ZpVDfTtObl2zF0/Is0cKIAxDOBmJsBurisoWK3DOjd6v9dN2fVMg6sVppHIsPztRVi11tM0/xOMLRce3efufqLCtKhfbYe5eOcP0Xw+Y/rNR0hObJmMCe8WT0b4NH36wHji9KDSdQKcCZy003qaTBdmdj/lpfyzulyyKPBhP/5/7z66w3/3lBnBEFQPoPET1Q770UKDZFuJPZdHHN0gye7v82dRKKPk+vzqxjQmPu9iJ7o8TvGhkTXv21k+EqHcctTT2SyLCF4/aEA7/naUmXaC7FXQlTsbsZ0Sye/8LHIXgzau6AibBdhYW2yiRuyFlI/DqxqKuvAhnOaJ3/Gi8UZu72xJXe7mjDGQzLJ9QuCw2TOoK2+mj5vF2X17wnGOHr+c4pVC+B/keQXYWlVw2CogzFKVbhqk2YqXvg8DyDrLk+fG3Ri2o8v1U3ZNsurpkPUDUQClViogWG4jiCt0aLxpDhVmmWCAfpaB+eTyzrNuXDDh0iUjro7uvCfNDTNS8bQ7iUTMTNy2Ra/tMxwbdRdq8h3+0CYtahyeMX8PihjgAIDVVwxbNKopdfiwdYyhTMmwDBtPGy8nN/lzWNTaMXzTCDNrVwYAJc8WnylyiHnea9ce4el2xLcmX9jPpAFMkxbR0xSKRwQEXuMwgRTE4I0GgMXw==

Try again.

Correct.

Incorrect.

Question 7.37

duK98oQuXsPGsfgkjRtZb0gLdBThIUDk/q70FdwC531k/egIIC5i4C2ARzVeQ6scDsH0n0eiwzS0J2OZWVzzl48kRgo/3Cjd25D98MKDOsOitfdJj9udqIJB305Z+2W3ew6f2NYyNGWrQrZH9bJ1AF8lsZok+xYOvvvBevbJPO9Jc+u6rS9js88zNhvYZ9U036tqRgmbwavFP0AzJ2sqLN6cYj9wKNN9d7afhY0jZDTH892w8mle8V1IRqzxhEfmxL6wgHj+bzEqAZQ5mt6dOHCKV0NKu005jgK7hCzc8Vl0Y+lrwGL+XkcaoRMGqCThna/vB1ln6GvLMgQbBotRiHdpSBjgGQy9lOM/PUW3OOXPxQOm/EyUNLpf8deAP9HAzJ+d1fAEs3CIsPV69my4IkYMUSESBKN0fHXbZrAf19hquzjV9Es8fR/y5E2bMFnxvakHdNVIz8tm5xmaZduMjeo6HfaOaC6GkswQ7XAxbShvdHg9Z0chth24mSTBsmqAqPgBo0gqgcIHElNAMYCrYDCKldcE2q8erYZXPlcnJNjOjrlDe9zQVD1IkEue6mlxdP/onqcr3argKYoNbA2p8/SqxFVZ2KBkAaeJtbMck13SXSziGS49VBZcvfFufPFAQFsGXSMGU+xG1kVMAL8mjg==

Try again.

Correct.

Incorrect.

Related Vocabulary

Question 7.38

8r+4sMEuGBEWvkart8eyRXBBQ8Vn+SK4NGP7SmPqcz+gy7A2fFBRQu5RydP0D7Yb/Lg9rqpiON8p7Zqf8WGQsTmA8kOvI2GgrBJOX0E5f3VLLb4XHlLabvukvMhFupXYa511JCluvm6fa3ccy95fvojHpPjSu1ubwc1Y280D+bkA3g73x1TBPq+ulm0=

7.4 Driving Question 3

Driving Question 3

How does DNA profiling make use of genetic variation in DNA sequences?

Why should you care?

With a total of about 3 billion nucleotide pairs in the DNA of each human cell, building DNA profiles of a victim of a crime and all suspects using the entire genome would be extremely expensive and time consuming. Instead, forensic scientists analyze short segments of DNA called short tandem repeats (STRs). These short sequences are present at specific locations on everyone’s chromosomes, but they may be repeated different numbers of times on the different chromosomes of each individual.

To compare DNA samples from a victim of a crime to that of a suspect, forensic scientists create a visual image called a DNA profile. Multiple STR regions from each sample are amplified by PCR, generating DNA fragments of varying length. Gel electrophoresis separates these amplified STRs by length. When the DNA fragments in the gel are stained, each sample reveals a unique banding pattern that can easily be compared with others. This process was used to make profiles of the DNA found on the victim and of Roy Brown’s DNA.

Typically, 5% to 20% of people share the same DNA profile at any one STR site. To match DNA profiles with a high degree of certainty, forensic scientists must analyze many STRs at once. STR repeats at 15 sites are used in forensic DNA profiling, giving these tests a very high level of discrimination. When Roy Brown’s DNA profile proved to be different from that of the DNA taken from the victim, Innocence Project lawyers were able to exclude him as Kulakowski’s murderer.

What should you know?

To fully answer this Driving Question, you should be able to:

Understand and explain what a single tandem repeat STR is.
Understand and explain how people can differ in the number of times an STR is repeated along each of their chromosomes.
Understand and explain how PCR and gel electrophoresis are used together to create a DNA profile.
Given a picture of a gel, be able to describe the DNA profile of each individual and the similarities and differences among individuals.
Understand why multiple STR sites must be used if DNA profiling is to be reliably used to match a DNA sample with an individual suspect.

Infographic Focus

The infographics most pertinent to the Driving Question are 7.5, 7.6, and 7.7.

Question Test Your Vocabulary

Choose the correct term for each of the following definitions:

Term	Definition
PIT3oBYWgq2q1fAEfwkGfx8ezGT656tdKsoIajt15gCkgSEiKvyWyjiBNMai7L+3sIX5LQNQVfCMMFcqM3vYl8naaZtEBucR	A laboratory technique that separates fragments of DNA by size.
9kwubnarPc2EF0TM+UIuSVTKwv7lGIAn11HzLl1BytBaEkUFuUHfwJApUu7EvQgMD7uVM9rU2/Rrbih49K+5ZyRhyClljg1n	One complete set of genetic instructions encoded in the DNA of an organism.
poJTdkYMAIeWoowsVgyp1FbzNOnS0NZKVt4eMV8EO9K8ObTVV40g69/9cJNbpVxHKfjFcUjeFi3hWRRekwIGrtzmR7/qD3lY	A visual representation of a person’s unique DNA sequence.
RrzqNsnv168rtgHJhcWSxVs1yGAED5tv0dWQHxCB+RQNSEDbqLkvXyS7fxL2vo9QFd7o1/ykHqx2sdSXU3p8S+XDcykWkgHv	Sections of a chromosome in which DNA sequences are repeated.

Table

Try again.

Correct.

Incorrect.

Understand and explain what a single tandem repeat (STR) is.

In Infographic 7.5, examine the noncoding regions in the depicted DNA molecule corresponding to maternal chromosome 7 (i.e., the regions with the blue backbone) of person 1. Assume that the nucleotides are color coded as follows: yellow, A; red, G; green, C; blue, T.

Question 7.39

qML7Hl0/05YUnsc3kucR9iCeLxOjiUa2qmbSBk7KBXjscPIMDU2AlrfmjGFMeqdrwzF2ibhosOE=

AGCT

Question 7.40

waqp8ldMPO9h2tGCoK/aWJfCIMzEDbFdVatdf8EbxLiEXxV6K1V/iZ9P7dNW0/sltCvywTHgmQqg0bdzDYofUpITQxnM5EuFWiJAEhHbTnknzFehgIttBQ==

six

Understand and explain how people can differ in the number of times an STR is repeated along each of their chromosomes.

Question 7.41

Use the steps from the previous question to compare and contrast the STRs on the maternal and paternal chromosomes shown for each of the three people in Infographic 7.5. Enter your answers in the table.

	STR Sequence	STR repeats on maternal (top) chromosome	STR repeats on paternal (bottom) chromosome
Person 1	T24kks7PQGokL/DPS7nEJ3XXjvk=	yBhAQ+3VvjM=	h4XZagboIgc=
Person 2	T24kks7PQGokL/DPS7nEJ3XXjvk=	yBhAQ+3VvjM=	yBhAQ+3VvjM=
Person 3	T24kks7PQGokL/DPS7nEJ3XXjvk=	XvVM00l89Is=	L6bSXEGJIC8=

Table

Correct.

Try again.

Incorrect.

Question 7.42

b9Yo4fgmGo2W/mmOm4KjY/rRwzLVOVpUKwV2rKSlvx0mh8uBQ5WQtwKSBTukbF9vVYEpnadz1i4gTZl+4xNc08B+jzX0va5M/DlCVmJjL8RwkxEbE8/yckMF2qmBmRPlpFvWexZ6diTn4tiXH5sVBxeoe4V7QjhNjcsfiPY06T+K7C0jdIsZDo7CCJW8+0XQycYCBWK7/elbYDYLwY5uBJNAobFCnMJbTUNdAh6YFKkOZwvw9+y5CrSEcp3K+XBAOoZm3rc6NqE8Xnju

The chromosomes do not all have the same number of repeats, nor do each individual’s maternal and paternal chromosomes.

Understand and explain how PCR and gel electrophoresis are used together to build a DNA profile.

Question 7.43

ZoSeckDZ9o0jdzYg5O82/jPfkN1W94klWWZDUoO4qbjpq5icazLZN6tJhFfLbL082m29ieBgKmbxEzZ7UNnzcTG3vZGbeXsu2XHuYbwd0UAQtl9S/DkEU4adeY1dV7Qg

PCR is used to amplify the DNA at multiple STR regions.

Question 7.44

0WUwDOwdXRRwTisy7WzMlCL+chh5XGAaNf3q7C5QFQtExdrhDo5IWKp/i8K7XCiGB3m6WGwIYwji/eGxzh50HKJbhqcyqnTruedoxp6/SlASbz4p/fX3RFH+MtoQDd8h0PT1/D8Ab2mMPkHwj+pypk4yiZlE1a0OBOrLQg==

Gel electrophoresis is used to separate fragments of DNA by length. The shorter the fragment of DNA, the more quickly it moves through the gel.

Question 7.45

zfImMp35gWTfuT/HWQN6la3pxxOFR8ZX8xKFe5M9p11smZLaYJtxvzcHixzwUnaF9OCStFfqUm+TPM5lUqISUxEpIURO+FC8tv+52IhbGekyZs+yZt0Pg0M0KVPSZFyIVFZfy4D6f6a6zLchI1PYAbe0iSo=

STRs are a good source of DNA for profiling because the length of the DNA will vary, depending on how many copies of the STR are present.

Given a picture of a gel, be able to describe the DNA profile of each individual and the similarities and differences among individuals.

Question 7.46

How do we read DNA profiles? Examine the picture of the gel from Infographic 7.6 in your textbook and use it to answer the questions.

Fill in the table with the correct number of different STR lengths for each band.

	Number of STR Lengths
Sample	Green Band	Blue Band	Red Band
Saliva	aPHx0IhLgWWBJq1cPowxTA==	XvVM00l89Is=	0VV1JcqyBrI=
Person A	aPHx0IhLgWWBJq1cPowxTA==	XvVM00l89Is=	XvVM00l89Is=
Person B	UvgfJSR3chb765uq4ADtvg==	XvVM00l89Is=	XvVM00l89Is=
Person C	aPHx0IhLgWWBJq1cPowxTA==	XvVM00l89Is=	0VV1JcqyBrI=

Table

Correct.

Try again.

Incorrect.

Question 7.47

0iN+mShsdNiGQEqnpQwhC8k/B13qsa2AG1dmxXDi+Cg4pIwbxVit7BTLAE7WDyn9MR5zfHc2a6DLJLDbQDR7NKkj9Z7R5cB1gnwX3hrymVqF9S+g

Same number of green and blue bands, although STR lengths are different.

Question 7.48

KEApsD1U1xH/en9ydEhPZJqoFxfA+/+Ud+88/G0GPIbrEFUQ9psweLrfO3fGdTNRMvUKBed0jiayGrd4pniqf7D0aFLSULpUW8gvP5/6V40DtQmT

Same number of blue bands; lengths are identical.

Question 7.49

8TlZoa+7HCNFHOrHrc3ERc4Hmb9eyIvWht4af3wXb1UjajmuWfWSlxOryDnV0R+RdL3yFqxUBYTHOKzZ6qNzGPdrujgQk4E184vlNxK/Pr3GPjUx

Same number of green, blue, and red bands; lengths are identical.

Question 7.50

1zXczgcfXFQT+IjddXj6rDTt4oBHSgpKH6ixcqm+//ik0AAyreYzvVYsEPgOfgLEshZodg==

Person C

Understand why multiple STR sites must be used if DNA profiling can reliably be used to match a DNA sample with an individual suspect.

Why must forensic scientists analyze many STRs to reliably match a crime scene DNA sample to an individual suspect? If needed, refer to Infographic 7.7.

Assume for the purposes of this exercise that the odds of two people sharing STR patterns at any given STR site is 5% (0.05). This is an oversimplification, but it will help you understand the logic of using multiple STR sites. If the probability of two people sharing STR patterns is 5%, then we can calculate the odds of those same two people matching STR patterns at multiple sites as follows:

Matching at two sites: 0.05 x 0.05 = 0.0025 (0.25%)
Matching at three sites: 0.05 x 0.05 x 0.05 = 0.000125 (0.0125%)
Matching at four sites: 0.05 x 0.05 x 0.05 x 0.05 = 0.0000625 (0.00625%).

Question 7.51

yhmbgtHUotN1x86GFWM//b8tDxhHkUcVdl650mcbDvL42C2UGOn/3LLe2TkpY1VTPAdOtvouHXNoQ/SEkucBkBbrwiPHUzjpYsRRFIIUb/kQjywtJwLnHhdL3Iw=

At five sites it would be 0.05⁵ or 1 in approximately 3.2 million.
At 10 sites it would be 0.05¹⁰ or approximately 1 in 10.2 trillion.
At 15 sites it would be 0.05¹⁵ or 1 in approximately 327.7 sextillion.

Question 7.52

VoGyTyECUiWaKPLyIRHOCozDCzWkLX88m+V/Fwla4tAccB0/ALCLFfPEIZfL7IvGsEIYGiGcuFca2EcqK6inBvQvn8xciPTM6cq9Y7Sue8oR3NOT7s3mWoJZB6hW6fuqtu1C1lPbi+dW6+kbIVgh2l28c9fFntRwQECksg==

The more STR sites included in the analysis, the less likely the chance that two people match by coincidence (or chance).

Review Questions

Question 7.53

Below are letters representing the nucleotide sequence of one of the DNA strands in a noncoding region within a given maternal and paternal chromosome from two different people. Each contains a hypothetical STR region. Use the diagram to answer the questions.

Person 1

- Maternal Chromosome: ACTGACTTGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCTAG

- Paternal Chromosome: ACTGACTTGCCGCCGCCGCCGCCGCCGCCTAG

Person 2

- Maternal Chromosome: ACTGACTTGCCGCCGCCGCCGCCGCCGCCTAG

- Paternal Chromosome: ACTGACTTGCCGCCGCCGCCGCCGCCGCCTAG

9j9cynvbrnCZybDKUp24jJODNPq0QLgYlN6dKhWpcReUJSVJWxUVnGKPpnZIF6wvR0l2bvyXQtH45E2j8Q3Q7mFIf1xrdLzZlfKfBcS4Y5C3Ym9sC0kCkKE69GlZ0K2WSHN2V5EyuW8=

Try again.

Correct.

Incorrect.

Question 7.54

8y6ZDti8Ax7Ta0HEsIGSSNU5wXLRh1Gl7ToM0ko/KbTdmdbuYwS5Gd7s6MYfUYVKO65v7PI2NVgjrVplWJ+9AEZIumLIi75EQ+ofS5HkAORB6e30X+5RjGeO7pJy0zNyOHF/Jd+UGWLJd+tgxZ6IO8bMevgSoIhC7JVyPkcftLwN1NKHRldDZ363WxstCtF0NMzpNMw3frIKjeIyAUL8DaaFSKjH91gkrHwetUZNUzNWa5jld8DxD4Jr7dYSGB2KQVadqpIumaoE53yyNxelkON4E5rbmqepEx+KAPJAR9Hn27TmvzWD5HZwHRdjIfVTBfmBPB7ex+PdAWwshaqjWqLogI17WYmwZeJlYGM88yKKL8JVzMMWonLIcIzDlOro4/5swJvu5WUg4/pl+5yk860B3mYVAWvK

Try again.

Correct.

Incorrect.

Question 7.55

DKJ+vqi2BbXHiNT97hcFFJKTetcd9G7jophaU6C5ZyRFFXHPHE5OwIE5sdBA2kI83NCnj5SCN2oHOXOrcmDwAvEoWh/D26EHfpj05BVxIfs+S4vwio0wFipLJl/nn/T/d5ghWx5fMtQyOOWibPUT58LVFQ/OGg29Tdb/yNYoPpW7UBuXnRXIuhNDZd9bGp3nkCM96xNRM2XYOh5Qbkwxr1iqDtB+mxsJLgrXTDTn20yleKT+n8bGDAdNgFLLPfiae6l0eS9Xp/siPx9x6+WQR1zNlSjqEeIuhAno570qn3T8s5gtvAO3Nj3qbFD8BlM8iCjaWTf4tmA/ngTz2kGI0Z+9TLgFcog4GR4gnuRC40AVmAUHP1JKwukjNhpBK6JG9SLRQsf7mpSK1kG31udX6NBJ1LGGW5IshlzEnA==

Try again.

Correct.

Incorrect.

Question 7.56

0smLy9X09q+I5B7NVyhi0oEbkYkO/4Q/gIVGDV8VFI2hFMk0R6810cAVy4DLEf8XLIG+U+idoCo1rZ5+WopRbkAjuNYUbiq4QGppBh28ecksfnZlXTT2g25widPcrtrjzP3Yn2eFrrtCiyp2s0DCPh6UbY4n+PsSfI7vBzP7Zi3mNqQA8qIWs2lnpFUYxrB+KPjrwgrq11aBXF6fEE/B2WRQrhLJmJARxP3X5RNZoGw=

Try again.

Correct.

Incorrect.

Related Vocabulary

Question 7.57

a+oshyBm+yEmM7107cVhV+xJttsx7Qm5az1FpmZGkAkQhxwSj+brJSm9cCkZL+zPZKckUkxzCBH0vn3kwujDMrpm2n7n98aGRlwQG+eo8e0u3ws6IMFeFqiAPnCAMIv9OynPCIhGPDc+FDUQzkLDBz5alzW6/8iFT/5p+oATg2bcQ79NEZ3WoLGSQAJ4iR+3wcq/jLg5CQY/hg6ZG+Uphblj6xVcQrILjW4yeJTmbw2paHTAtgf/IZUWw6ix6TEUK5QluLrSmwH0CXMY

7.5 Driving Question 4

Driving Question 4

How does DNA evidence fit into forensic investigations?

Why should you care?

DNA evidence provides forensic investigations with data that are not biased with human judgment, prejudices, or errors. DNA profiling has proved helpful in more than 190,000 cases and has exonerated more than 300 wrongly convicted people. As a tool in forensic investigations, DNA has become the gold standard of evidence.

What should you know?

To fully answer this Driving Question, you should be able to:

Understand and describe the origin and function of DNA.
Understand and describe which feature of DNA varies among individuals, making each of us unique.
Understand and explain how PCR produces large amounts of DNA very rapidly.
Understand and explain what an STR is.
Understand and explain how people can differ in the number of times an STR is repeated along each of their chromosomes.
Understand why multiple STR sites must be used if DNA profiling can reliably be used to match a DNA sample with an individual suspect.

Infographic Focus

The infographics most pertinent to the Driving Question are 7.1, 7.5, 7.6, and 7.7.

Know all vocabulary words from Chapter 7 to answer this Driving Question.

You are a forensics expert called to testify on behalf of a woman who Innocence Project lawyers believe has been falsely imprisoned for murder. Your job is to answer a series of questions that will help the jury understand the DNA evidence collected at the crime scene but only recently analyzed. To that end, the lawyer will ask you a series of questions; your answers must be scientifically accurate but given in language that the jury, some of whom may not know anything about DNA, can understand. Here are the questions:

Question 7.58

PdEbnSci1LKjwcKYXRxAirWHsd2FGjvmyzRRuhHNwXT+EXc8la6POIaeG217EvSOEreilWirhspX8y+5H/cQF0hGzPN5iE9UFDnKxOxLboukGC/tzuv3hQBDbr9APOJUvuEnHT2DVhwEvewW1o71LgreWKN5dybIlcyWKasNAuz/emTXKBbrOunkbGH8dyoAW9NLm9QM5M0ohf7XbD0ydvo+xOZYLO0NSRky0hb6sFMPrq+i/nOedQzrgDLJ37zsFgl8KkzcEROHK7uzu3Ahd2vZgtxC2lHeJHPBsU8sC04gXNNCIiGtRe5ACU2ViTY9AwTzYAg5yyE8PqrZ

Hair and bite mark samples are not conclusive evidence to identify a person. Bite marks are notoriously troublesome, since error rates of correctly identifying a person based on their bite pattern are as high as 91%. Hair samples can exclude someone from suspicion but cannot positively identify one. DNA evidence, on the other hand, is now the gold standard used to positively identify a person from material left at a crime scene. Each person’s DNA is unique with the exception of identical twins. Taking advantage of this unique property, scientists can collect DNA from evidence at a crime scene and compare it to DNA collected from suspects of the crime and look for matches.

Question 7.59

srNApihTtebfgsWguYMnL5AGlguy94HV6mKH+LmeKN5Rnzve8BXXyXlzCtPhX0EhE4sfzTUfvRAAXoLwiLyfSkS2Bs4OJKpWYSGqav/82A+rBOHtaORS3WJOZhmswJoq30Etan28O4lo2j0yOcHV7Fxbq132w01IewY+oiq/QOnEPYNJEInCFQDHCKpgBw74qmakaR8ntsA=

Scientists have a process, called polymerase chain reaction, or PCR, in which small amounts of DNA are amplified to very large amounts without changing the sequence of the DNA. Forensic scientists look at specific regions of the DNA called short tandem repeats, or STRs, blocks of repeated DNA sequences. Each person has a particular number of these repeated sequences in their DNA, so this can be used by scientists to determine whether a sample matches a suspect’s DNA.

Question 7.60

RD+Mr6tNFTzqZd8SCZhnkaXtFcCsUP32a+9sd6EU2nuzk8ODB/0zv4S6GWVjpdSqHqdlPTa5J5MWhjGxG3/c9Xs6CuOqMQdPmfsBjLzC+bxzaPgitBjB40HvYZPf8xe7xSdbYumrEU5yXgZIg7A0BNJX7lqOHX+Jou/DP6cC8ftU0QcN1BxtpZRtbyJz93kAEcLPTvHngpRclpfVy2pSwJp6s6O3CSxNcAQTl2IqvBpKqfK68ajaOaQdgBOM3o+lMalODAaQNmYFQutMBpyWydVV4mbjym6AHFptx8Ikwl761seQioF+tJuFdb4XVu4V1B1n5zfzlmjOdpNcOPu5SUssoC20eOsfFPx4eENqf+zYwDdXVioEBwUivfM=

No, the DNA analyzed by forensic scientists look at specific regions of the DNA called STRs. Short Tandem Repeats are blocks of repeated DNA sequences. Each person has a particular number of these repeated sequences in their DNA, so this can be used by scientists to determine if a sample matches a suspect’s DNA

Question 7.61

Zr3DRMhVJu3kZfQOrWctE9EVEm+zZ/QShWRRs2nd0lZpLXNgY7Cjkumoy4gWMOxJrZO4Au4S21hTVg6Csy9CAcb5F6Jxv99cWJ3iJBUlH8ZNkduIKr7j7dCY2uVr8HxdNltl7W2wunGx8HVM3KgzA1BfIBYb0VJ7AgaY5ANUFTTZ/+ZIiE/rTjJ9rnibvEmKU5mZxfVp1/p7bpbmw7Uf4cOCooQOT/3/mRGSYqYs7HkWOrnAk/DWUNu7VGOxQ/VH/Ds8wR93KKRFLrB03oLDZyF3quuxRzrHcYCdUr7Q3b/smcsMXW1Qm06zw2Q98QwcizeCQcr2Au1HeIxe9LFZ1gTl/VvrV9cTeICPqhxAyPRVIPopHffLVPPQz8AHZwQDtpbyvQ36t8/h3UjttznlxupJxbAohh2IzW6fXj2ERQskT90WVyIukvT8BHn/ocxOQGut0sghxhHJWZ8g

This could happen if only one or two STR regions were studied. However, 15 STR regions are typically used to identify a person by DNA. The odds of two people sharing the same 15 STR region characteristics is 1 in several quintillion or higher.