The following RNA polymer is added to an E. coli extract, where it can be translated in all three possible reading frames. Which amino acids can be polymerized into polypeptides in this system?

5′-AUAUAUAUAUAUAUAUAUAUAUAUAUAU-3′

Given a polynucleotide that encodes polymethionine, what other polypeptides will also be produced?

Translate the following mRNA into protein, starting from the first initiation codon:

5′-CCGAUGCCAUGGCAGCUCGGUGUUAC

AAGGCUUGCAUCAGUACCAGUUUGAAUCC-3′

From the sequence of a protein, we can gain some information about the gene sequence that encodes it. However, because of the degeneracy of the genetic code, there are many possible nucleotide sequences that could encode a given protein sequence. The usefulness of genomic databases in searching for the genes for proteins of known sequence is made clear by considering the following. How many possible RNA molecules can encode the peptide Met-Asn-Trp-Tyr? How many if a Leu residue is added to the end of the peptide?

Shown below is the 5′ end of an mRNA molecule. What are the first three (N-terminal) amino acids of its protein product?

5′-AUGUGUUGAUGUAUCAGACCUGUC – – –

Translate the following mRNA, starting at the first 5′ nucleotide, assuming that translation occurs in an E. coli cell. If all tRNAs make maximum use of wobble rules but do not contain inosine, how many distinct tRNAs are required to translate this RNA?

5′-AUGGGUCGUGAGUCAUCGUUAAUUGUAGCU

GGAGGGGAGGAAUGA-3′

How does the answer to Problem 6 change if the RNA is translated in yeast mitochondria?

For the following RNA sequence, which positions can tolerate a mutation without resulting in a change in amino acid sequence? What changes are tolerated at each position?

5′-AUGAUAUUGCUAUCUUGGACU-3′

A researcher wants to explore the function of one segment of a protein, extending across six amino acid residues. Her plan is to change the amino acids at each position and determine how that affects the activity of the protein. She wants to make as many amino acid substitutions as possible, but quickly discovers that she cannot make all the changes she wants if she changes only one codon nucleotide. The sequence of the mRNA specifying that part of the protein is given below, along with the amino acid sequence it encodes. Below the amino acid sequence, list all the amino acids that could be substituted at each position if the researcher changed only one nucleotide in the codon for that particular amino acid.

What polypeptide sequence will be made from the following RNA sequence?

5′-AUGCCUCGUCAGGUGUAAAGUCAGGCUUGA-3′

What tRNA^Tyr suppressor mutation will provide read-through of the first stop codon, and what will the resulting peptide sequence be?

What are the sequences of the polypeptides produced from these repeating nucleotide sequences: (a) poly(AG); (b) poly(UG); (c) poly(CAA); (d) poly(AAG); (e) poly (UUAC)?

A researcher uses polynucleotide phosphorylase to create random RNA polymers, using a UDP:CDP ratio of 5:1. Codons should be generated in the following proportions, assuming random incorporation of the NDPs by polynucleotide phosphorylase: UUU (83.3), U₂C (16.7), UC₂ (3.3), and CCC (0.7). The following amino acids are incorporated into protein, in the proportions shown in parentheses: leucine (22.2), phenylalanine (100), proline (5.1), and serine (23.6). What are the probable codon assignments of these four amino acids? Keep in mind that poly(U) codes for poly(Phe), and poly(C) codes for poly(Pro).

Polyglycine is translated from the repeating sequence 5′-(GGU-GGC-GGA)_n-3′. If only one tRNA is needed to make polyglycine, what can you say about the tRNA anticodon?

The stop codon UGA is also used to specify the amino acid selenocysteine (Sec) in a few proteins in the cells of most organisms. Why is Sec not added to all proteins at UGA codons? What protein and RNA elements are needed to permit the addition of Sec to proteins at a particular UGA codon in E. coli?

A gene with a frameshift mutation caused by the insertion of one nucleotide produces inactive protein. A second frameshift, caused by the deletion of one nucleotide at some position downstream of the original mutation, reactivates the gene. The final protein product contains four amino acid residues that differ from the wild-type protein. The two mutations occur in the following sequence:

5′– – – CATCATCATCATCATCATCATCATCAT – – –

What is the maximum number of nucleotides between the two point mutations? What is the minimum number?

Given the following mRNA sequence, which reading frame is most likely to encode part of a protein?

5′-ACGUCGAGUAGCAGUAUCGAUUGAGC

UCUUAGAUAAGAUCGC

Given the wobble rules, at least 31 tRNAs are necessary to decipher the genetic code. Only 6 tRNAs are needed to insert the four amino acids Phe, Leu, Ile, and Met. Using the table below, hypothesize the anticodon sequences of the 6 tRNAs. Multiple answers are possible.