Watson and Crick’s discovery of the structure of DNA suggested the hypothesis that hereditary information is stored as a sequence of bases along long strands of DNA. This remarkable insight provided an entirely new way of thinking about biology. However, at the time that it was made, Watson and Crick’s discovery, though full of potential, remained to be confirmed and many features needed to be elucidated. How is the sequence information read and translated into action? What are the sequences of naturally occurring DNA molecules and how can such sequences be experimentally determined? Through advances in biochemistry and related sciences, we now have essentially complete answers to these questions. Indeed, in the past decade or so, scientists have determined the complete genome sequences of hundreds of different organisms, including simple microorganisms, plants, animals of varying degrees of complexity, and human beings. Comparisons of these genome sequences, with the use of methods introduced in (Chapter 6), have been sources of many insights that have transformed biochemistry. In addition to its experimental and clinical aspects, biochemistry has now become an information science.

The sequencing of a human genome was a daunting task because it contains approximately 3 billion (3 × 10⁹) base pairs. For example, the sequence

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGA…

is a part of one of the genes that encodes hemoglobin, the oxygen carrier in our blood. This gene is found on the end of chromosome 9 of our 24 distinct chromosomes. If we were to include the complete sequence of our entire genome, this chapter would run to more than 500,000 pages. The sequencing of our genome is truly a landmark in human history. This sequence contains a vast amount of information, some of which we can now extract and interpret, but much of which we are only beginning to understand. For example, some human diseases have been linked to particular variations in genomic sequence. Sickle-cell anemia, discussed in detail in (Chapter 7), is caused by a single base change of an A (noted in boldface type in the preceding sequence) to a T. We will encounter many other examples of diseases that have been linked to specific DNA sequence changes.

18

Determining the first human genome sequences was a great challenge. It required the efforts of large teams of geneticists, molecular biologists, biochemists, and computer scientists, as well as billions of dollars, because there was no previous framework for aligning the sequences of various DNA fragments. One human genome sequence can serve as a reference for other sequences. The availability of such reference sequences enables much more rapid characterization of partial or complete genomes from other individuals. As we will discuss in (Chapter 5), arrays containing millions of target single-stranded DNA molecules with sequences from the reference genome and known or potential variants are powerful tools. These arrays can be exposed to mixtures of DNA fragments for a particular individual and those single-stranded targets that bind to their complementary strands can be determined. This allows many positions within the genome of the individual to be simulaneously interrogated.

Methods for sequencing DNA have also been improving rapidly, driven by a deep understanding of the biochemistry of DNA replication and other processes. This has resulted in both dramatic increases in the DNA sequencing rate and decreases in cost (Figure 1.19). The availability of such powerful sequencing technology is transforming many fields, including medicine, dentistry, microbiology, pharmacology, and ecology, although a great deal remains to be done to improve the accuracy and precision of the interpretation of these large genomic and related data sets.

Each person has a unique sequence of DNA base pairs. How different are we from one another at the genomic level? Examination of genomic variation reveals that, on average, each pair of individuals has a different base in one position per 200 bases; that is, the difference is approximately 0.5%. This variation between individuals who are not closely related is quite substantial compared with differences in populations. The average difference between two people within one ethnic group is greater than the difference between the averages of two different ethnic groups.

The significance of much of this genetic variation is not understood. As noted earlier, variation in a single base within the genome can lead to a disease such as sickle-cell anemia. Scientists have now identified the genetic variations associated with hundreds of diseases for which the cause can be traced to a single gene. For other diseases and traits, we know that variation in many different genes contributes in significant and often complex ways. Many of the most prevalent human ailments such as heart disease are linked to variations in many genes. Furthermore, in most cases, the presence of a particular variation or set of variations does not inevitably result in the onset of a disease but, instead, leads to a predisposition to the development of the disease.

Our own genes are not the only ones that can contribute to health and disease. Our bodies, including our skin, mouth, digestive tract, genitourinary tract, respiratory tract, and other areas, contain large number of microorganisms. These complex communities have been characterized through powerful methods that allow DNA isolated from these biological samples to be sequenced without any previous knowledge of the organisms present. Many of these organisms had not previously been discovered because they can only grow as part of complex communities and thus cannot be isolated through standard microbiological techniques. Remarkably, it appears that we are outnumbered in our own bodies! Each of us contains approximately ten times more microbials cells than human cells and these microbial cells include many more genes than do our own genomes. These microbiomes differ from site to site, from one person to another and over time in the same individual. They appear to play roles in health and in diseases such as obesity and dental caries (Figure 1.20).

19

In addition to the implications for understanding human health and disease, the genome sequence is a source of deep insight into other aspects of human biology and culture. For example, by comparing the sequences of different individuals and populations, we can learn a great deal about human history. On the basis of such analysis, a compelling case can be made that the human species originated in Africa, and the occurrence and even the timing of important migrations of groups of human beings can be demonstrated (Figure 1.21). Finally, comparisons of the human genome with the genomes of other organisms are confirming the tremendous unity that exists at the level of biochemistry and are revealing key steps in the course of evolution from relatively simple, single-celled organisms to complex, multicellular organisms such as human beings. For example, many genes that are key to the function of the human brain and nervous system have evolutionary and functional relatives in the genomes of bacteria. Because many studies that are possible in model organisms are difficult or unethical to conduct in human beings, these discoveries have many practical implications. Comparative genomics has become a powerful science, linking evolution and biochemistry.

20

Although our genetic makeup (and that of our microbiomes) is an important factor that contributes to disease susceptibility and to other traits, factors in a person’s environment also are significant. What are these environmental factors? Perhaps the most obvious are chemicals that we eat or are exposed to in some other way. The adage “you are what you eat” has considerable validity; it applies both to substances that we ingest in significant quantities and to those that we ingest in only trace amounts. Throughout our study of biochemistry, we will encounter vitamins and trace elements and their derivatives that play crucial roles in many processes. In many cases, the roles of these chemicals were first revealed through investigation of deficiency disorders observed in people who do not take in a sufficient quantity of a particular vitamin or trace element. Despite the fact that the most important essential dietary factors have been known for some time, new roles for them continue to be discovered.

A healthful diet requires a balance of major food groups. In addition to providing vitamins and trace elements, food provides calories in the form of substances that can be broken down to release energy that drives other biochemical processes. Proteins, fats, and carbohydrates provide the building blocks used to construct the molecules of life (Figure 1.22). Finally, it is possible to get too much of a good thing. Human beings evolved under circumstances in which food, particularly rich foods such as meat, was scarce. With the development of agriculture and modern economies, rich foods are now plentiful in parts of the world. Some of the most prevalent diseases in the so-called developed world, such as heart disease and diabetes, can be attributed to the large quantities of fats and carbohydrates present in modern diets. We are now developing a deeper understanding of the biochemical consequences of these diets and the interplay between diet and genetic factors.

Chemicals are only one important class of environmental factors. Our behaviors also have biochemical consequences. Through physical activity, we consume the calories that we take in, ensuring an appropriate balance between food intake and energy expenditure. Activities ranging from exercise to emotional responses such as fear and love may activate specific biochemical pathways, leading to changes in levels of gene expression, the release of hormones, and other consequences. Furthermore, the interplay between biochemistry and behavior is bidirectional. Just as our biochemistry is affected by our behavior, so, too, our behavior is affected, although certainly not completely determined, by our genetic makeup and other aspects of our biochemistry. Genetic factors associated with a range of behavioral characteristics have been at least tentatively identified.

Just as vitamin deficiencies and genetic diseases have revealed fundamental principles of biochemistry and biology, investigations of variations in behavior and their linkage to genetic and biochemical factors are potential sources of great insight into mechanisms within the brain. For example, studies of drug addiction have revealed neural circuits and biochemical pathways that greatly influence aspects of behavior. Unraveling the interplay between biology and behavior is one of the great challenges in modern science, and biochemistry is providing some of the most important concepts and tools for this endeavor.

21

The structure of DNA revealed how information is stored in the base sequence along a DNA strand. But what information is stored and how is it expressed? The most fundamental role of DNA is to encode the sequences of proteins. Like DNA, proteins are linear polymers. However, proteins differ from DNA in two important ways. First, proteins are built from 20 building blocks, called amino acids, rather than just four, as in DNA. The chemical complexity provided by this variety of building blocks enables proteins to perform a wide range of functions. Second, proteins spontaneously fold into elaborate three-dimensional structures, determined only by their amino acid sequences (Figure 1.23). We have explored in depth how solutions containing two appropriate strands of DNA come together to form a solution of double-helical molecules. A similar spontaneous folding process gives proteins their three-dimensional structure. A balance of hydrogen bonding, van der Waals interactions, and hydrophobic interactions overcomes the entropy lost in going from an unfolded ensemble of proteins to a homogenous set of well-folded molecules. Proteins and protein folding will be discussed extensively in (Chapter 2).

The fundamental unit of hereditary information, the gene, is becoming increasingly difficult to precisely define as our knowledge of the complexities of genetics and genomics increases. The genes that are simplest to define encode the sequences of proteins. For these protein-encoding genes, a block of DNA bases encodes the amino acid sequence of a specific protein molecule. A set of three bases along the DNA strand, called a codon, determines the identity of one amino acid within the protein sequence. The set of rules that links the DNA sequence to the encoded protein sequence is called the genetic code. One of the biggest surprises from the sequencing of the human genome is the small number of protein-encoding genes. Before the genome-sequencing project began, the consensus view was that the human genome would include approximately 100,000 protein-encoding genes. The current analysis suggests that the actual number is between 20,000 and 25,000. We shall use an estimate of 21,000 throughout this book. However, additional mechanisms allow many genes to encode more than one protein. For example, the genetic information in some genes is translated in more than one way to produce a set of proteins that differ from one another in parts of their amino acid sequences. In other cases, proteins are modified after they have been synthesized through the addition of accessory chemical groups. Through these indirect mechanisms, much more complexity is encoded in our genomes than would be expected from the number of protein-encoding genes alone.

On the basis of current knowledge, the protein-encoding regions account for only about 3% of the human genome. What is the function of the rest of the DNA? Some of it contains information that regulates the expression of specific genes (i.e., the production of specific proteins) in particular cell types and physiological conditions. Essentially every human cell contains the same DNA genome, yet cell types differ considerably in the proteins that they produce. For example, hemoglobin is expressed only in precursors of red blood cells, even though the genes for hemoglobin are present in essentially every cell. Specific sets of genes are expressed in response to hormones, even though these genes are not expressed in the same cell in the absence of the hormones. The control regions that regulate such differences account for only a small amount of the remainder of our genomes. The truth is that we do not yet understand all of the function of much of the remainder of the DNA. Some of it is sometimes referred to as “junk”—stretches of DNA that were inserted at some stage of evolution and have remained. In some cases, this DNA may, in fact, serve important functions. In others, it may serve no function but, because it does not cause significant harm, it has remained.

22